Incidental Mutation 'R0017:Ptpro'
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
MMRRC Submission 038312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0017 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137416827 bp
Amino Acid Change Valine to Alanine at position 831 (V831A)
Ref Sequence ENSEMBL: ENSMUSP00000127112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
Predicted Effect probably benign
Transcript: ENSMUST00000077115
AA Change: V831A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V831A

signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167002
AA Change: V10A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: V10A

transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167679
AA Change: V831A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V831A

signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203914
AA Change: V10A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: V10A

signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204780
Meta Mutation Damage Score 0.0785 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.2%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,008,106 probably benign Het
Abca13 T A 11: 9,292,775 I1546N probably damaging Het
Actrt3 A T 3: 30,598,273 M224K probably benign Het
Adgrv1 T C 13: 81,578,946 N429S probably benign Het
Appbp2 A C 11: 85,214,303 C146G possibly damaging Het
Cabp2 A C 19: 4,086,242 D83A possibly damaging Het
Ccl1 A G 11: 82,178,017 probably null Het
Cdca8 T C 4: 124,920,375 T208A probably benign Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dcdc5 G A 2: 106,357,196 noncoding transcript Het
Efr3b C A 12: 3,993,003 C89F probably damaging Het
Enpp3 C T 10: 24,799,153 probably null Het
Ep400 A T 5: 110,673,529 V2467E probably damaging Het
Ermap T C 4: 119,179,948 probably benign Het
Fig4 A G 10: 41,273,007 Y150H possibly damaging Het
Fsip2 G A 2: 82,992,072 V6050M probably damaging Het
Gm11397 A C 13: 33,404,511 I360L probably damaging Het
Gnb1l T C 16: 18,541,060 W72R probably damaging Het
Gpld1 A G 13: 24,990,118 D842G probably damaging Het
Hmgcr A G 13: 96,652,089 probably benign Het
Hrc A G 7: 45,336,370 H315R possibly damaging Het
Ifit2 A T 19: 34,573,573 N171I probably damaging Het
Ipo11 T A 13: 106,886,730 I416L probably benign Het
Kcnab1 G A 3: 65,357,106 V259M probably damaging Het
Kcng4 T C 8: 119,633,520 Y39C probably damaging Het
Kif5c A G 2: 49,732,713 T526A probably benign Het
Kntc1 A G 5: 123,780,981 Y805C probably damaging Het
Mal A G 2: 127,640,307 S59P probably damaging Het
Myh15 A G 16: 49,163,060 N1513D probably damaging Het
Ncoa2 A G 1: 13,174,752 L574P probably damaging Het
Nmd3 A G 3: 69,736,092 probably null Het
Nucb2 A G 7: 116,533,151 D331G probably benign Het
Nwd1 T C 8: 72,709,425 probably benign Het
Nynrin T C 14: 55,872,395 F1653S probably damaging Het
Olfr1253 A C 2: 89,752,021 I269S possibly damaging Het
Olfr371 T A 8: 85,231,077 I194N probably benign Het
Olfr875 T G 9: 37,772,978 F106L probably benign Het
Pfdn6 T C 17: 33,939,564 R79G probably damaging Het
Pkd1 G T 17: 24,578,539 probably null Het
Pramel4 T G 4: 144,068,344 C434G probably benign Het
Ptpn13 T C 5: 103,486,772 probably null Het
Rabl6 A T 2: 25,602,567 probably benign Het
Reg3b T A 6: 78,372,861 M128K possibly damaging Het
Rif1 A G 2: 52,116,674 T2207A probably benign Het
Rpa1 A C 11: 75,314,861 N223K probably null Het
Rras2 T C 7: 114,048,255 probably benign Het
Ryr1 T A 7: 29,047,542 E3760V probably damaging Het
Scyl3 T A 1: 163,939,969 I204N possibly damaging Het
Slc16a12 A G 19: 34,672,698 probably benign Het
Slc22a1 A G 17: 12,659,759 F356L probably damaging Het
Slc22a29 A G 19: 8,218,266 probably benign Het
Slc45a1 C A 4: 150,629,566 D741Y possibly damaging Het
Slco1a5 A T 6: 142,236,335 probably benign Het
Smg5 G T 3: 88,351,105 R461L probably damaging Het
Snrk T C 9: 122,166,240 S362P probably damaging Het
Spata31d1b A G 13: 59,716,069 S344G probably benign Het
Sync G A 4: 129,293,744 V190M probably damaging Het
Taf5l T C 8: 124,003,644 Y67C probably damaging Het
Tbkbp1 A G 11: 97,146,289 probably benign Het
Tshr A T 12: 91,537,886 I533F possibly damaging Het
Tsn T C 1: 118,300,859 D211G probably damaging Het
Ttn G A 2: 76,791,644 T15518I probably benign Het
Unc13c T C 9: 73,693,301 D1387G probably benign Het
Vapb A G 2: 173,771,604 T99A probably benign Het
Vmn2r-ps119 A G 17: 19,153,617 noncoding transcript Het
Zfp280d A T 9: 72,339,010 probably null Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
Brau UTSW 6 137454598 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
Hoff UTSW 6 137443594 missense probably damaging 1.00
Jester UTSW 6 137449917 missense probably damaging 1.00
mann UTSW 6 137411116 splice site probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
R7019:Ptpro UTSW 6 137380478 missense probably benign
R7218:Ptpro UTSW 6 137454598 missense probably damaging 1.00
R7236:Ptpro UTSW 6 137368337 missense probably damaging 1.00
R7299:Ptpro UTSW 6 137441144 critical splice donor site probably null
R7381:Ptpro UTSW 6 137399561 missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137382649 missense probably benign 0.01
R7733:Ptpro UTSW 6 137414286 nonsense probably null
R7793:Ptpro UTSW 6 137416820 missense probably damaging 0.99
R7804:Ptpro UTSW 6 137399601 splice site probably null
R7833:Ptpro UTSW 6 137416863 nonsense probably null
R7859:Ptpro UTSW 6 137392807 critical splice donor site probably null
R7873:Ptpro UTSW 6 137430739 missense probably benign 0.44
R8042:Ptpro UTSW 6 137416883 missense possibly damaging 0.71
Z1177:Ptpro UTSW 6 137378140 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ttccatcatcacatcatcatcatc -3'
Posted On2013-04-11