Incidental Mutation 'R1751:Jmjd1c'
ID193527
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Namejumonji domain containing 1C
SynonymsTRIP8, D630035I23Rik, 5430433L24Rik
MMRRC Submission 039783-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R1751 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location67096125-67256326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67225690 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1274 (L1274P)
Ref Sequence ENSEMBL: ENSMUSP00000134551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174317] [ENSMUST00000174408]
Predicted Effect probably benign
Transcript: ENSMUST00000051446
AA Change: L1274P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: L1274P

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173689
AA Change: L1093P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876
AA Change: L1093P

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174317
SMART Domains Protein: ENSMUSP00000134246
Gene: ENSMUSG00000037876

DomainStartEndE-ValueType
Blast:JmjC 1 744 N/A BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174408
AA Change: L1274P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: L1274P

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bank1 G T 3: 136,234,614 R203S probably benign Het
Bank1 A G 3: 136,254,937 V53A probably benign Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cdc5l A T 17: 45,407,805 D628E probably benign Het
Chd3 G A 11: 69,353,901 probably benign Het
Clstn3 A T 6: 124,431,999 W860R probably damaging Het
Cntn4 G A 6: 106,618,410 probably null Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Cyp2b9 T C 7: 26,186,675 V89A probably benign Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gart A C 16: 91,642,949 probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gnas T A 2: 174,297,894 probably benign Het
Greb1 A G 12: 16,723,438 probably benign Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gucy2c A T 6: 136,748,775 probably benign Het
Igf2r A C 17: 12,697,441 S1677A possibly damaging Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrp6 A G 6: 134,464,568 L1145S probably damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Nol8 A T 13: 49,667,408 T914S probably benign Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr109 A T 17: 37,466,901 M232L probably benign Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pcp4 A C 16: 96,525,489 Q290P probably damaging Het
Pdlim1 C T 19: 40,251,904 probably benign Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Pik3c2a A C 7: 116,346,236 V1445G probably damaging Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Plxnc1 A G 10: 94,849,815 probably benign Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rfx2 A G 17: 56,784,754 V313A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Sbpl A G 17: 23,954,803 probably null Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Setbp1 T C 18: 78,857,398 D1018G probably damaging Het
Slc38a11 T A 2: 65,350,108 I182F probably benign Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Smarca2 T C 19: 26,640,380 probably benign Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Stox1 T C 10: 62,659,666 T943A probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Trpc7 T A 13: 56,776,143 D743V probably damaging Het
Trrap T C 5: 144,814,575 probably null Het
Tsc1 A G 2: 28,676,026 I485V probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Tsr3 T C 17: 25,242,639 I317T possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r108 A T 17: 20,462,524 V806E probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zfp108 C A 7: 24,261,896 H637Q probably damaging Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67226715 missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67249762 missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67232015 missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67219526 missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67243869 missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67220392 missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67220322 missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67226382 missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67225861 missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67225336 missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67219654 missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67225498 missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67232070 missense probably damaging 0.99
Accordion UTSW 10 67233414 missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67229913 missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67219326 missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67240808 missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67219109 missense unknown
R0396:Jmjd1c UTSW 10 67219523 missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67220382 missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67255482 missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67240727 missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67225755 missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67225789 missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67226809 missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67218946 splice site probably null
R0755:Jmjd1c UTSW 10 67096599 intron probably benign
R1142:Jmjd1c UTSW 10 67225345 missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67239236 splice site probably benign
R1413:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67219875 missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67224809 missense probably benign 0.02
R1950:Jmjd1c UTSW 10 67239922 missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67225440 missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 67157998 nonsense probably null
R2061:Jmjd1c UTSW 10 67218426 missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67239463 splice site probably null
R2203:Jmjd1c UTSW 10 67239463 splice site probably null
R2256:Jmjd1c UTSW 10 67225294 missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67238850 missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67255500 missense probably benign
R2392:Jmjd1c UTSW 10 67229904 missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 67157932 missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67240084 splice site probably benign
R4043:Jmjd1c UTSW 10 67219466 missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67219008 missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67219753 missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 67096681 intron probably benign
R4352:Jmjd1c UTSW 10 67244809 missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 67157974 nonsense probably null
R4717:Jmjd1c UTSW 10 67158051 nonsense probably null
R4741:Jmjd1c UTSW 10 67224939 missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67224792 missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67233446 missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67218971 missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67246137 missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67232016 missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67240701 missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67218149 missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67249762 missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67233414 missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67226078 missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67230006 missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67220333 missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67226512 missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67240012 missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67248048 missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67220408 missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67249660 missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67225939 missense probably benign
R6430:Jmjd1c UTSW 10 67224160 missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67226016 missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67189820 missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67217090 missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67220609 missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67219632 missense probably benign 0.39
R7113:Jmjd1c UTSW 10 67158001 missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67226065 missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67189817 missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67218364 missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67189758 missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67217036 missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67225313 missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67232015 missense probably damaging 0.99
R7699:Jmjd1c UTSW 10 67218416 missense probably benign 0.10
R7745:Jmjd1c UTSW 10 67217045 missense probably damaging 0.96
R7897:Jmjd1c UTSW 10 67239865 missense probably damaging 0.96
R7908:Jmjd1c UTSW 10 67225842 missense probably benign
R7911:Jmjd1c UTSW 10 67231995 missense probably damaging 1.00
R7967:Jmjd1c UTSW 10 67249682 missense probably damaging 1.00
R8058:Jmjd1c UTSW 10 67254495 missense not run
R8224:Jmjd1c UTSW 10 67244849 missense noncoding transcript
R8251:Jmjd1c UTSW 10 67239289 missense noncoding transcript
RF011:Jmjd1c UTSW 10 67220199 missense possibly damaging 0.47
Z1088:Jmjd1c UTSW 10 67238174 missense probably benign
Z1176:Jmjd1c UTSW 10 67238174 missense probably benign
Z1177:Jmjd1c UTSW 10 67238174 missense probably benign
Z1177:Jmjd1c UTSW 10 67246125 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAAGCAGCTACAGTAGCCTTTCCC -3'
(R):5'- CTGCACTACTCAAGCTGGAGACAC -3'

Sequencing Primer
(F):5'- AGTAGCCTTTCCCCTCCAAC -3'
(R):5'- CACATCTGCTTTGGTAGTAGAGAC -3'
Posted On2014-05-23