Incidental Mutation 'R1751:Tsc22d1'
ID193545
Institutional Source Beutler Lab
Gene Symbol Tsc22d1
Ensembl Gene ENSMUSG00000022010
Gene NameTSC22 domain family, member 1
SynonymsTSC-22, Tgfb1i4, Egr5
MMRRC Submission 039783-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R1751 (G1)
Quality Score166
Status Validated
Chromosome14
Chromosomal Location76414961-76507765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76418102 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 674 (S674P)
Ref Sequence ENSEMBL: ENSMUSP00000044517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048371] [ENSMUST00000110888] [ENSMUST00000175984] [ENSMUST00000176581] [ENSMUST00000176886] [ENSMUST00000177471]
Predicted Effect probably damaging
Transcript: ENSMUST00000048371
AA Change: S674P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010
AA Change: S674P

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 461 489 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
low complexity region 537 556 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 673 687 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 933 970 N/A INTRINSIC
Pfam:TSC22 992 1048 7e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110888
AA Change: S592P

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010
AA Change: S592P

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 415 439 N/A INTRINSIC
low complexity region 455 474 N/A INTRINSIC
internal_repeat_1 502 536 8.43e-5 PROSPERO
low complexity region 537 555 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
internal_repeat_1 644 676 8.43e-5 PROSPERO
low complexity region 851 888 N/A INTRINSIC
Pfam:TSC22 910 969 4.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175984
SMART Domains Protein: ENSMUSP00000135307
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 77 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176581
SMART Domains Protein: ENSMUSP00000135789
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 78 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177333
Predicted Effect probably benign
Transcript: ENSMUST00000177471
SMART Domains Protein: ENSMUSP00000134792
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 18 55 N/A INTRINSIC
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bank1 G T 3: 136,234,614 R203S probably benign Het
Bank1 A G 3: 136,254,937 V53A probably benign Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cdc5l A T 17: 45,407,805 D628E probably benign Het
Chd3 G A 11: 69,353,901 probably benign Het
Clstn3 A T 6: 124,431,999 W860R probably damaging Het
Cntn4 G A 6: 106,618,410 probably null Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Cyp2b9 T C 7: 26,186,675 V89A probably benign Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gart A C 16: 91,642,949 probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gnas T A 2: 174,297,894 probably benign Het
Greb1 A G 12: 16,723,438 probably benign Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gucy2c A T 6: 136,748,775 probably benign Het
Igf2r A C 17: 12,697,441 S1677A possibly damaging Het
Jmjd1c T C 10: 67,225,690 L1274P probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrp6 A G 6: 134,464,568 L1145S probably damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Nol8 A T 13: 49,667,408 T914S probably benign Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr109 A T 17: 37,466,901 M232L probably benign Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pcp4 A C 16: 96,525,489 Q290P probably damaging Het
Pdlim1 C T 19: 40,251,904 probably benign Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Pik3c2a A C 7: 116,346,236 V1445G probably damaging Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Plxnc1 A G 10: 94,849,815 probably benign Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rfx2 A G 17: 56,784,754 V313A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Sbpl A G 17: 23,954,803 probably null Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Setbp1 T C 18: 78,857,398 D1018G probably damaging Het
Slc38a11 T A 2: 65,350,108 I182F probably benign Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Smarca2 T C 19: 26,640,380 probably benign Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Stox1 T C 10: 62,659,666 T943A probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Trpc7 T A 13: 56,776,143 D743V probably damaging Het
Trrap T C 5: 144,814,575 probably null Het
Tsc1 A G 2: 28,676,026 I485V probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Tsr3 T C 17: 25,242,639 I317T possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r108 A T 17: 20,462,524 V806E probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zfp108 C A 7: 24,261,896 H637Q probably damaging Het
Other mutations in Tsc22d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tsc22d1 APN 14 76418917 missense probably damaging 0.99
IGL00515:Tsc22d1 APN 14 76418477 missense probably damaging 0.99
IGL00703:Tsc22d1 APN 14 76504828 missense possibly damaging 0.62
IGL00974:Tsc22d1 APN 14 76506442 missense probably damaging 1.00
IGL01015:Tsc22d1 APN 14 76418741 missense possibly damaging 0.66
IGL01515:Tsc22d1 APN 14 76505299 critical splice donor site probably null
IGL02172:Tsc22d1 APN 14 76417692 missense probably benign 0.04
IGL02307:Tsc22d1 APN 14 76416461 missense probably damaging 0.99
IGL02553:Tsc22d1 APN 14 76417398 missense possibly damaging 0.73
IGL02870:Tsc22d1 APN 14 76417617 missense probably benign 0.42
IGL02989:Tsc22d1 APN 14 76418901 missense probably benign 0.05
IGL03216:Tsc22d1 APN 14 76418637 missense probably benign 0.02
R0127:Tsc22d1 UTSW 14 76418981 missense possibly damaging 0.92
R0416:Tsc22d1 UTSW 14 76505303 splice site probably benign
R0854:Tsc22d1 UTSW 14 76418201 nonsense probably null
R0963:Tsc22d1 UTSW 14 76418599 missense possibly damaging 0.92
R1370:Tsc22d1 UTSW 14 76437664 intron probably benign
R1736:Tsc22d1 UTSW 14 76418357 missense probably benign 0.08
R1760:Tsc22d1 UTSW 14 76416948 missense possibly damaging 0.69
R1767:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R2020:Tsc22d1 UTSW 14 76418333 missense probably damaging 1.00
R2209:Tsc22d1 UTSW 14 76418740 missense probably damaging 1.00
R2439:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R2471:Tsc22d1 UTSW 14 76418204 missense probably benign 0.00
R3114:Tsc22d1 UTSW 14 76417337 missense probably damaging 1.00
R3907:Tsc22d1 UTSW 14 76416543 missense probably damaging 0.98
R3973:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3974:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3975:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3976:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R4292:Tsc22d1 UTSW 14 76418880 missense probably benign 0.12
R4612:Tsc22d1 UTSW 14 76419005 missense possibly damaging 0.66
R4806:Tsc22d1 UTSW 14 76416988 splice site probably null
R4980:Tsc22d1 UTSW 14 76418256 missense probably benign 0.02
R5068:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5070:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5239:Tsc22d1 UTSW 14 76418412 missense probably damaging 0.99
R5360:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R5400:Tsc22d1 UTSW 14 76417054 missense probably benign 0.00
R5616:Tsc22d1 UTSW 14 76416217 unclassified probably benign
R5726:Tsc22d1 UTSW 14 76505317 nonsense probably null
R5934:Tsc22d1 UTSW 14 76418826 missense possibly damaging 0.87
R6860:Tsc22d1 UTSW 14 76418292 missense possibly damaging 0.73
R6904:Tsc22d1 UTSW 14 76506483 nonsense probably null
R7016:Tsc22d1 UTSW 14 76417542 missense probably damaging 1.00
R7274:Tsc22d1 UTSW 14 76416714 missense probably damaging 0.98
R7482:Tsc22d1 UTSW 14 76418487 missense probably benign 0.10
R7532:Tsc22d1 UTSW 14 76416046 unclassified probably benign
R7536:Tsc22d1 UTSW 14 76504763 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGCAGACTCTTCAGCCTGTCC -3'
(R):5'- ACCGATACTTGCAATCTGACCGCC -3'

Sequencing Primer
(F):5'- TCTGCAAGCCACCATGAGTG -3'
(R):5'- TGTTTGAGCCTGGCCAAT -3'
Posted On2014-05-23