Mutagenetix > Incidental Mutation

Incidental Mutation 'R0017:Fig4'

19360

Institutional Source

Beutler Lab

Gene Symbol

Fig4

Ensembl Gene

ENSMUSG00000038417

Gene Name

FIG4 phosphoinositide 5-phosphatase

Synonyms

A530089I17Rik

MMRRC Submission

038312-MU

Accession Numbers

Ncbi RefSeq: NM_133999.1; MGI:2143585

Essential gene?

Possibly non essential (E-score: 0.399) question?

Stock #

R0017 (G1)

Quality Score

119

Status

Not validated

Chromosome

Chromosomal Location

41188172-41303260 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41273007 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 150 (Y150H)

Ref Sequence

ENSEMBL: ENSMUSP00000039598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043814]

AlphaFold

Q91WF7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043814
AA Change: Y150H

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039598
Gene: ENSMUSG00000038417
AA Change: Y150H

Domain	Start	End	E-Value	Type
Pfam:Syja_N	93	424	1.7e-79	PFAM
Blast:Lactamase_B	533	610	6e-21	BLAST
low complexity region	742	771	N/A	INTRINSIC
low complexity region	805	813	N/A	INTRINSIC

Meta Mutation Damage Score

0.4379

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 95.0%
20x: 89.2%

Validation Efficiency

96% (76/79)

MGI Phenotype

Strain: 3716838
Lethality: D30-D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, severe tremors, diluted coat color, neurodegeneration, impaired coordination, muscle weakness, small size and reduced spleen. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted(3) Gene trapped(12) Spontaneous(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	T	17: 9,008,106		probably benign	Het
Abca13	T	A	11: 9,292,775	I1546N	probably damaging	Het
Actrt3	A	T	3: 30,598,273	M224K	probably benign	Het
Adgrv1	T	C	13: 81,578,946	N429S	probably benign	Het
Appbp2	A	C	11: 85,214,303	C146G	possibly damaging	Het
Cabp2	A	C	19: 4,086,242	D83A	possibly damaging	Het
Ccl1	A	G	11: 82,178,017		probably null	Het
Cdca8	T	C	4: 124,920,375	T208A	probably benign	Het
Dach1	C	T	14: 98,168,748	G188R	probably damaging	Het
Dcdc5	G	A	2: 106,357,196		noncoding transcript	Het
Efr3b	C	A	12: 3,993,003	C89F	probably damaging	Het
Enpp3	C	T	10: 24,799,153		probably null	Het
Ep400	A	T	5: 110,673,529	V2467E	probably damaging	Het
Ermap	T	C	4: 119,179,948		probably benign	Het
Fsip2	G	A	2: 82,992,072	V6050M	probably damaging	Het
Gm11397	A	C	13: 33,404,511	I360L	probably damaging	Het
Gnb1l	T	C	16: 18,541,060	W72R	probably damaging	Het
Gpld1	A	G	13: 24,990,118	D842G	probably damaging	Het
Hmgcr	A	G	13: 96,652,089		probably benign	Het
Hrc	A	G	7: 45,336,370	H315R	possibly damaging	Het
Ifit2	A	T	19: 34,573,573	N171I	probably damaging	Het
Ipo11	T	A	13: 106,886,730	I416L	probably benign	Het
Kcnab1	G	A	3: 65,357,106	V259M	probably damaging	Het
Kcng4	T	C	8: 119,633,520	Y39C	probably damaging	Het
Kif5c	A	G	2: 49,732,713	T526A	probably benign	Het
Kntc1	A	G	5: 123,780,981	Y805C	probably damaging	Het
Mal	A	G	2: 127,640,307	S59P	probably damaging	Het
Myh15	A	G	16: 49,163,060	N1513D	probably damaging	Het
Ncoa2	A	G	1: 13,174,752	L574P	probably damaging	Het
Nmd3	A	G	3: 69,736,092		probably null	Het
Nucb2	A	G	7: 116,533,151	D331G	probably benign	Het
Nwd1	T	C	8: 72,709,425		probably benign	Het
Nynrin	T	C	14: 55,872,395	F1653S	probably damaging	Het
Olfr1253	A	C	2: 89,752,021	I269S	possibly damaging	Het
Olfr371	T	A	8: 85,231,077	I194N	probably benign	Het
Olfr875	T	G	9: 37,772,978	F106L	probably benign	Het
Pfdn6	T	C	17: 33,939,564	R79G	probably damaging	Het
Pkd1	G	T	17: 24,578,539		probably null	Het
Pramel4	T	G	4: 144,068,344	C434G	probably benign	Het
Ptpn13	T	C	5: 103,486,772		probably null	Het
Ptpro	T	C	6: 137,416,827	V831A	probably benign	Het
Rabl6	A	T	2: 25,602,567		probably benign	Het
Reg3b	T	A	6: 78,372,861	M128K	possibly damaging	Het
Rif1	A	G	2: 52,116,674	T2207A	probably benign	Het
Rpa1	A	C	11: 75,314,861	N223K	probably null	Het
Rras2	T	C	7: 114,048,255		probably benign	Het
Ryr1	T	A	7: 29,047,542	E3760V	probably damaging	Het
Scyl3	T	A	1: 163,939,969	I204N	possibly damaging	Het
Slc16a12	A	G	19: 34,672,698		probably benign	Het
Slc22a1	A	G	17: 12,659,759	F356L	probably damaging	Het
Slc22a29	A	G	19: 8,218,266		probably benign	Het
Slc45a1	C	A	4: 150,629,566	D741Y	possibly damaging	Het
Slco1a5	A	T	6: 142,236,335		probably benign	Het
Smg5	G	T	3: 88,351,105	R461L	probably damaging	Het
Snrk	T	C	9: 122,166,240	S362P	probably damaging	Het
Spata31d1b	A	G	13: 59,716,069	S344G	probably benign	Het
Sync	G	A	4: 129,293,744	V190M	probably damaging	Het
Taf5l	T	C	8: 124,003,644	Y67C	probably damaging	Het
Tbkbp1	A	G	11: 97,146,289		probably benign	Het
Tshr	A	T	12: 91,537,886	I533F	possibly damaging	Het
Tsn	T	C	1: 118,300,859	D211G	probably damaging	Het
Ttn	G	A	2: 76,791,644	T15518I	probably benign	Het
Unc13c	T	C	9: 73,693,301	D1387G	probably benign	Het
Vapb	A	G	2: 173,771,604	T99A	probably benign	Het
Vmn2r-ps119	A	G	17: 19,153,617		noncoding transcript	Het
Zfp280d	A	T	9: 72,339,010		probably null	Het

Other mutations in Fig4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Fig4	APN	10	41251788	missense	probably damaging	0.99
IGL01013:Fig4	APN	10	41267786	missense	probably benign	0.00
IGL01066:Fig4	APN	10	41285417	splice site	probably benign
IGL01501:Fig4	APN	10	41270374	missense	probably benign
IGL01503:Fig4	APN	10	41256518	missense	probably benign	0.00
IGL01535:Fig4	APN	10	41256494	missense	probably benign	0.00
IGL01733:Fig4	APN	10	41277393	missense	possibly damaging	0.49
IGL01782:Fig4	APN	10	41270400	missense	probably benign	0.18
IGL01866:Fig4	APN	10	41232164	missense	possibly damaging	0.77
IGL01934:Fig4	APN	10	41228112	missense	probably benign	0.03
IGL01966:Fig4	APN	10	41232102	splice site	probably null
IGL02032:Fig4	APN	10	41303006	missense	probably benign	0.00
IGL02225:Fig4	APN	10	41256452	missense	probably benign
IGL02345:Fig4	APN	10	41267774	missense	probably null	1.00
IGL02532:Fig4	APN	10	41285281	splice site	probably benign
IGL02686:Fig4	APN	10	41264004	missense	probably damaging	0.99
IGL02965:Fig4	APN	10	41285665	missense	probably damaging	0.98
P0021:Fig4	UTSW	10	41251825	missense	probably damaging	1.00
R0017:Fig4	UTSW	10	41273007	missense	possibly damaging	0.94
R0117:Fig4	UTSW	10	41230041	nonsense	probably null
R0144:Fig4	UTSW	10	41258049	missense	probably damaging	0.99
R0655:Fig4	UTSW	10	41285677	missense	probably damaging	1.00
R0701:Fig4	UTSW	10	41240512	nonsense	probably null
R0751:Fig4	UTSW	10	41272982	missense	probably damaging	1.00
R1540:Fig4	UTSW	10	41188586	missense	possibly damaging	0.60
R1586:Fig4	UTSW	10	41265427	missense	probably damaging	0.99
R2916:Fig4	UTSW	10	41258075	missense	probably damaging	0.98
R3927:Fig4	UTSW	10	41263139	missense	probably benign
R4304:Fig4	UTSW	10	41256427	missense	probably benign	0.01
R4586:Fig4	UTSW	10	41188632	missense	probably damaging	1.00
R4678:Fig4	UTSW	10	41272998	missense	probably benign	0.27
R4858:Fig4	UTSW	10	41233590	missense	probably benign	0.00
R5614:Fig4	UTSW	10	41272985	missense	probably damaging	0.98
R5896:Fig4	UTSW	10	41254885	missense	possibly damaging	0.67
R6126:Fig4	UTSW	10	41265447	missense	probably damaging	0.99
R7056:Fig4	UTSW	10	41220932	missense	probably benign	0.09
R7350:Fig4	UTSW	10	41251756	missense	probably benign	0.03
R7452:Fig4	UTSW	10	41240637	missense	possibly damaging	0.88
R7481:Fig4	UTSW	10	41230005	critical splice donor site	probably null
R7610:Fig4	UTSW	10	41253713	missense	probably damaging	1.00
R7818:Fig4	UTSW	10	41263166	missense	probably damaging	0.98
R7830:Fig4	UTSW	10	41256466	missense	probably benign	0.00
R8263:Fig4	UTSW	10	41267715	nonsense	probably null
R8319:Fig4	UTSW	10	41263101	missense	probably damaging	1.00
R8409:Fig4	UTSW	10	41265431	missense	probably benign	0.01
R8435:Fig4	UTSW	10	41285674	missense	probably benign
R8474:Fig4	UTSW	10	41232174	missense	probably benign	0.30
R9086:Fig4	UTSW	10	41285403	missense	possibly damaging	0.50
R9131:Fig4	UTSW	10	41265411	missense	possibly damaging	0.95
R9248:Fig4	UTSW	10	41277482	missense	probably benign
R9401:Fig4	UTSW	10	41267737	missense	probably benign
R9564:Fig4	UTSW	10	41285391	missense	probably benign	0.20
R9627:Fig4	UTSW	10	41232182	missense	probably benign	0.01
R9649:Fig4	UTSW	10	41267767	missense	probably benign	0.00
Z1088:Fig4	UTSW	10	41253731	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTATTCACTTACAGGGCCACCAGC -3'
(R):5'- GCGATGATTGGCAGATGCACAC -3'

Sequencing Primer
(F):5'- ACTGTTACACCTCTGCATTAGAAC -3'
(R):5'- CAGCTCAGTGAGCACACTTA -3'

Posted On

2013-04-11