Incidental Mutation 'R1752:Tax1bp1'
ID193611
Institutional Source Beutler Lab
Gene Symbol Tax1bp1
Ensembl Gene ENSMUSG00000004535
Gene NameTax1 (human T cell leukemia virus type I) binding protein 1
Synonyms1700069J21Rik, 1200003J11Rik, D6Ertd404e, D6Ertd772e, T6BP, TXBP151
MMRRC Submission 039784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1752 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location52713729-52766780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52721413 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 37 (T37A)
Ref Sequence ENSEMBL: ENSMUSP00000119522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080723] [ENSMUST00000129660] [ENSMUST00000138040] [ENSMUST00000149588]
Predicted Effect probably damaging
Transcript: ENSMUST00000080723
AA Change: T37A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079548
Gene: ENSMUSG00000004535
AA Change: T37A

DomainStartEndE-ValueType
Pfam:CALCOCO1 15 416 2.6e-92 PFAM
coiled coil region 569 620 N/A INTRINSIC
ZnF_C2H2 753 778 7.57e1 SMART
ZnF_C2H2 780 805 3.21e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128173
Predicted Effect probably damaging
Transcript: ENSMUST00000129660
AA Change: T37A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122922
Gene: ENSMUSG00000004535
AA Change: T37A

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 87 3.2e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138040
AA Change: T37A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119522
Gene: ENSMUSG00000004535
AA Change: T37A

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 172 8.5e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149588
AA Change: T37A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116059
Gene: ENSMUSG00000004535
AA Change: T37A

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 161 2.3e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203787
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HTLV-1 tax1 binding protein. The encoded protein interacts with TNFAIP3, and inhibits TNF-induced apoptosis by mediating the TNFAIP3 anti-apoptotic activity. Degradation of this protein by caspase-3-like family proteins is associated with apoptosis induced by TNF. This protein may also have a role in the inhibition of inflammatory signaling pathways. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Knockout mice are born alive but fail to thrive and develop inflammatory cardiac valvulitis and dermatitis, die prematurely, and are hypersensitive to low doses of TNF and IL-1beta. In contrast, embryos homozygous for a gene trap mutation die at E13.5 from hemorrhaging and/or cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Accsl C T 2: 93,858,030 G420S probably damaging Het
Adam29 A G 8: 55,872,274 S382P probably damaging Het
Apob T C 12: 7,988,766 L393P probably benign Het
Arhgef19 T G 4: 141,251,043 S616A probably benign Het
Atp11a C T 8: 12,813,094 T91I probably damaging Het
Ccdc88b C T 19: 6,853,322 V751I probably benign Het
Ccni T C 5: 93,202,456 probably benign Het
Cd2 G A 3: 101,276,195 A266V probably benign Het
Cd33 T C 7: 43,532,298 D146G probably benign Het
Cdh16 A G 8: 104,619,873 probably null Het
Chd1 T C 17: 15,743,232 probably null Het
Chd5 A T 4: 152,375,133 I1109F probably damaging Het
Cir1 T C 2: 73,310,538 E29G probably damaging Het
Clec5a T C 6: 40,582,253 T66A probably damaging Het
Cpa2 A G 6: 30,552,024 D250G probably damaging Het
Crybg2 T A 4: 134,073,650 L707H probably damaging Het
Csmd3 T C 15: 47,660,273 T2646A probably benign Het
Cul7 G A 17: 46,653,167 R390Q probably benign Het
Cyp2c69 T A 19: 39,881,153 I141F probably damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Dclk2 C T 3: 86,806,127 V470I possibly damaging Het
Dixdc1 A G 9: 50,682,550 V530A probably benign Het
Dock7 A G 4: 98,966,444 F1528L probably damaging Het
Edn1 T A 13: 42,303,599 V36E possibly damaging Het
Eng T C 2: 32,673,392 V319A probably benign Het
Epb41l2 A G 10: 25,460,792 K229E probably damaging Het
Fam184a T C 10: 53,674,570 N698S probably benign Het
Fam208a T A 14: 27,471,928 Y1028* probably null Het
Fndc7 T C 3: 108,869,330 N465S probably benign Het
Fstl4 T C 11: 53,186,795 V793A probably benign Het
Gm884 T C 11: 103,614,555 T2196A possibly damaging Het
Gm9797 A T 10: 11,609,543 noncoding transcript Het
Hsd17b4 T C 18: 50,170,767 S436P probably benign Het
Itsn2 T G 12: 4,711,950 probably null Het
Kank3 T C 17: 33,819,817 V570A probably damaging Het
Kif13a A T 13: 46,798,409 F733Y probably damaging Het
Kif16b G T 2: 142,690,666 D1184E probably benign Het
Kif20a A G 18: 34,631,581 D727G possibly damaging Het
Kif20b T A 19: 34,938,336 S504R probably benign Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Luzp2 T C 7: 55,264,340 S306P possibly damaging Het
Macf1 T C 4: 123,483,672 I1490V possibly damaging Het
Manba T A 3: 135,506,945 W72R probably damaging Het
Mast1 A G 8: 84,925,336 V339A probably benign Het
Mnx1 A G 5: 29,477,729 S183P unknown Het
Muc5b T G 7: 141,867,751 L4326R possibly damaging Het
Myb T C 10: 21,156,437 D15G possibly damaging Het
Ncapg2 A T 12: 116,426,718 D429V probably damaging Het
Neurod6 A G 6: 55,679,526 V42A probably benign Het
Nfxl1 A T 5: 72,540,875 C276S probably damaging Het
Nptx2 C A 5: 144,555,361 T316N probably damaging Het
Nrp2 T A 1: 62,738,441 F135Y probably damaging Het
Nxpe3 A T 16: 55,866,474 F57Y probably benign Het
Olfr1214 C A 2: 88,987,315 A296S possibly damaging Het
Olfr610 T A 7: 103,506,558 R129S probably benign Het
Osbpl11 T C 16: 33,204,835 Y144H probably damaging Het
Pax5 T C 4: 44,609,729 Y233C probably damaging Het
Pck1 A G 2: 173,157,113 N388S probably benign Het
Plcd3 T A 11: 103,080,259 Q157L probably benign Het
Pnma2 A C 14: 66,916,336 M70L probably benign Het
Pogk T C 1: 166,408,428 K35E probably damaging Het
Ptprb T A 10: 116,340,990 V1227E probably benign Het
Pygm T A 19: 6,391,034 V450E probably damaging Het
Rb1 T A 14: 73,287,624 I190F probably damaging Het
Setd2 T A 9: 110,594,605 Y2243N probably damaging Het
Slc11a2 A T 15: 100,405,806 L182Q probably damaging Het
Slc45a3 T C 1: 131,977,521 L94P probably damaging Het
Slc9a4 T C 1: 40,629,261 F688S probably benign Het
Slit3 A T 11: 35,564,653 I196F probably damaging Het
Sprn G A 7: 140,153,495 probably benign Het
Spsb2 A G 6: 124,810,329 D242G probably benign Het
Srpk2 A G 5: 23,528,019 I111T probably damaging Het
St8sia4 T A 1: 95,591,812 Y317F probably benign Het
Stat5a T A 11: 100,884,058 *798K probably null Het
Sult1c1 C T 17: 53,964,749 V137M possibly damaging Het
Synj1 T C 16: 90,938,473 T1531A probably benign Het
Tet1 T A 10: 62,812,989 D1888V probably damaging Het
Tln1 T C 4: 43,536,311 T1994A probably damaging Het
Tmco3 A C 8: 13,291,741 D5A probably benign Het
Tnk1 T A 11: 69,856,706 N74I possibly damaging Het
Ttc16 A T 2: 32,772,150 S120T probably damaging Het
Ttn A G 2: 76,764,262 V20480A probably damaging Het
Ttn T A 2: 76,944,104 T2153S probably damaging Het
Usp4 T C 9: 108,374,242 Y539H probably damaging Het
Zar1 A C 5: 72,577,372 V168G probably damaging Het
Zcchc9 T C 13: 91,805,780 K119E possibly damaging Het
Zfp251 T C 15: 76,853,663 N410S possibly damaging Het
Zfp605 A T 5: 110,123,773 D10V probably damaging Het
Zyg11a A T 4: 108,205,282 N107K possibly damaging Het
Other mutations in Tax1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Tax1bp1 APN 6 52753366 missense probably benign 0.16
IGL03177:Tax1bp1 APN 6 52736947 missense possibly damaging 0.95
R0836:Tax1bp1 UTSW 6 52741940 splice site probably benign
R1119:Tax1bp1 UTSW 6 52741948 splice site probably benign
R1456:Tax1bp1 UTSW 6 52744244 missense probably benign 0.01
R1465:Tax1bp1 UTSW 6 52727194 splice site probably benign
R1484:Tax1bp1 UTSW 6 52733320 missense probably damaging 0.99
R1661:Tax1bp1 UTSW 6 52736912 missense probably benign 0.18
R1665:Tax1bp1 UTSW 6 52736912 missense probably benign 0.18
R1712:Tax1bp1 UTSW 6 52729326 missense probably damaging 1.00
R1913:Tax1bp1 UTSW 6 52765952 missense probably damaging 1.00
R2496:Tax1bp1 UTSW 6 52758357 critical splice donor site probably null
R3782:Tax1bp1 UTSW 6 52739548 missense probably damaging 1.00
R3804:Tax1bp1 UTSW 6 52742785 missense probably benign 0.45
R4238:Tax1bp1 UTSW 6 52766051 nonsense probably null
R4303:Tax1bp1 UTSW 6 52727278 missense possibly damaging 0.90
R4665:Tax1bp1 UTSW 6 52737131 missense probably benign 0.00
R4870:Tax1bp1 UTSW 6 52729493 intron probably benign
R5009:Tax1bp1 UTSW 6 52729493 intron probably benign
R5965:Tax1bp1 UTSW 6 52729332 missense probably damaging 1.00
R6313:Tax1bp1 UTSW 6 52744356 critical splice donor site probably null
R6328:Tax1bp1 UTSW 6 52746709 missense probably benign 0.03
R6338:Tax1bp1 UTSW 6 52729376 nonsense probably null
R6886:Tax1bp1 UTSW 6 52733223 missense probably benign 0.43
R7251:Tax1bp1 UTSW 6 52721356 missense possibly damaging 0.95
R7531:Tax1bp1 UTSW 6 52746697 missense probably benign 0.00
RF020:Tax1bp1 UTSW 6 52721354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGGAGAGCTGCATTGCAT -3'
(R):5'- AACCTGTGGAATTAAGTTCCCAGTGTTT -3'

Sequencing Primer
(F):5'- gactgagttgtatccccatcc -3'
(R):5'- caaagctgcctgctgcc -3'
Posted On2014-05-23