Incidental Mutation 'R1752:Olfr610'
ID193618
Institutional Source Beutler Lab
Gene Symbol Olfr610
Ensembl Gene ENSMUSG00000045584
Gene Nameolfactory receptor 610
SynonymsMOR9-2, GA_x6K02T2PBJ9-6221839-6220892
MMRRC Submission 039784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1752 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103505375-103512122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103506558 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 129 (R129S)
Ref Sequence ENSEMBL: ENSMUSP00000150921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063109] [ENSMUST00000217627]
Predicted Effect probably benign
Transcript: ENSMUST00000063109
AA Change: R129S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000052577
Gene: ENSMUSG00000045584
AA Change: R129S

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 3.5e-106 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1.9e-10 PFAM
Pfam:7tm_1 43 295 1.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213422
Predicted Effect probably benign
Transcript: ENSMUST00000217627
AA Change: R129S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Accsl C T 2: 93,858,030 G420S probably damaging Het
Adam29 A G 8: 55,872,274 S382P probably damaging Het
Apob T C 12: 7,988,766 L393P probably benign Het
Arhgef19 T G 4: 141,251,043 S616A probably benign Het
Atp11a C T 8: 12,813,094 T91I probably damaging Het
Ccdc88b C T 19: 6,853,322 V751I probably benign Het
Ccni T C 5: 93,202,456 probably benign Het
Cd2 G A 3: 101,276,195 A266V probably benign Het
Cd33 T C 7: 43,532,298 D146G probably benign Het
Cdh16 A G 8: 104,619,873 probably null Het
Chd1 T C 17: 15,743,232 probably null Het
Chd5 A T 4: 152,375,133 I1109F probably damaging Het
Cir1 T C 2: 73,310,538 E29G probably damaging Het
Clec5a T C 6: 40,582,253 T66A probably damaging Het
Cpa2 A G 6: 30,552,024 D250G probably damaging Het
Crybg2 T A 4: 134,073,650 L707H probably damaging Het
Csmd3 T C 15: 47,660,273 T2646A probably benign Het
Cul7 G A 17: 46,653,167 R390Q probably benign Het
Cyp2c69 T A 19: 39,881,153 I141F probably damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Dclk2 C T 3: 86,806,127 V470I possibly damaging Het
Dixdc1 A G 9: 50,682,550 V530A probably benign Het
Dock7 A G 4: 98,966,444 F1528L probably damaging Het
Edn1 T A 13: 42,303,599 V36E possibly damaging Het
Eng T C 2: 32,673,392 V319A probably benign Het
Epb41l2 A G 10: 25,460,792 K229E probably damaging Het
Fam184a T C 10: 53,674,570 N698S probably benign Het
Fam208a T A 14: 27,471,928 Y1028* probably null Het
Fndc7 T C 3: 108,869,330 N465S probably benign Het
Fstl4 T C 11: 53,186,795 V793A probably benign Het
Gm884 T C 11: 103,614,555 T2196A possibly damaging Het
Gm9797 A T 10: 11,609,543 noncoding transcript Het
Hsd17b4 T C 18: 50,170,767 S436P probably benign Het
Itsn2 T G 12: 4,711,950 probably null Het
Kank3 T C 17: 33,819,817 V570A probably damaging Het
Kif13a A T 13: 46,798,409 F733Y probably damaging Het
Kif16b G T 2: 142,690,666 D1184E probably benign Het
Kif20a A G 18: 34,631,581 D727G possibly damaging Het
Kif20b T A 19: 34,938,336 S504R probably benign Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Luzp2 T C 7: 55,264,340 S306P possibly damaging Het
Macf1 T C 4: 123,483,672 I1490V possibly damaging Het
Manba T A 3: 135,506,945 W72R probably damaging Het
Mast1 A G 8: 84,925,336 V339A probably benign Het
Mnx1 A G 5: 29,477,729 S183P unknown Het
Muc5b T G 7: 141,867,751 L4326R possibly damaging Het
Myb T C 10: 21,156,437 D15G possibly damaging Het
Ncapg2 A T 12: 116,426,718 D429V probably damaging Het
Neurod6 A G 6: 55,679,526 V42A probably benign Het
Nfxl1 A T 5: 72,540,875 C276S probably damaging Het
Nptx2 C A 5: 144,555,361 T316N probably damaging Het
Nrp2 T A 1: 62,738,441 F135Y probably damaging Het
Nxpe3 A T 16: 55,866,474 F57Y probably benign Het
Olfr1214 C A 2: 88,987,315 A296S possibly damaging Het
Osbpl11 T C 16: 33,204,835 Y144H probably damaging Het
Pax5 T C 4: 44,609,729 Y233C probably damaging Het
Pck1 A G 2: 173,157,113 N388S probably benign Het
Plcd3 T A 11: 103,080,259 Q157L probably benign Het
Pnma2 A C 14: 66,916,336 M70L probably benign Het
Pogk T C 1: 166,408,428 K35E probably damaging Het
Ptprb T A 10: 116,340,990 V1227E probably benign Het
Pygm T A 19: 6,391,034 V450E probably damaging Het
Rb1 T A 14: 73,287,624 I190F probably damaging Het
Setd2 T A 9: 110,594,605 Y2243N probably damaging Het
Slc11a2 A T 15: 100,405,806 L182Q probably damaging Het
Slc45a3 T C 1: 131,977,521 L94P probably damaging Het
Slc9a4 T C 1: 40,629,261 F688S probably benign Het
Slit3 A T 11: 35,564,653 I196F probably damaging Het
Sprn G A 7: 140,153,495 probably benign Het
Spsb2 A G 6: 124,810,329 D242G probably benign Het
Srpk2 A G 5: 23,528,019 I111T probably damaging Het
St8sia4 T A 1: 95,591,812 Y317F probably benign Het
Stat5a T A 11: 100,884,058 *798K probably null Het
Sult1c1 C T 17: 53,964,749 V137M possibly damaging Het
Synj1 T C 16: 90,938,473 T1531A probably benign Het
Tax1bp1 A G 6: 52,721,413 T37A probably damaging Het
Tet1 T A 10: 62,812,989 D1888V probably damaging Het
Tln1 T C 4: 43,536,311 T1994A probably damaging Het
Tmco3 A C 8: 13,291,741 D5A probably benign Het
Tnk1 T A 11: 69,856,706 N74I possibly damaging Het
Ttc16 A T 2: 32,772,150 S120T probably damaging Het
Ttn A G 2: 76,764,262 V20480A probably damaging Het
Ttn T A 2: 76,944,104 T2153S probably damaging Het
Usp4 T C 9: 108,374,242 Y539H probably damaging Het
Zar1 A C 5: 72,577,372 V168G probably damaging Het
Zcchc9 T C 13: 91,805,780 K119E possibly damaging Het
Zfp251 T C 15: 76,853,663 N410S possibly damaging Het
Zfp605 A T 5: 110,123,773 D10V probably damaging Het
Zyg11a A T 4: 108,205,282 N107K possibly damaging Het
Other mutations in Olfr610
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Olfr610 APN 7 103506796 missense possibly damaging 0.67
IGL02179:Olfr610 APN 7 103506727 missense probably damaging 1.00
IGL02303:Olfr610 APN 7 103506088 missense probably benign 0.05
IGL02507:Olfr610 APN 7 103506718 nonsense probably null
IGL02562:Olfr610 APN 7 103506216 nonsense probably null
IGL02806:Olfr610 APN 7 103506003 missense probably benign 0.10
R0743:Olfr610 UTSW 7 103506862 nonsense probably null
R0884:Olfr610 UTSW 7 103506862 nonsense probably null
R1673:Olfr610 UTSW 7 103506689 missense probably damaging 0.99
R1800:Olfr610 UTSW 7 103506041 missense possibly damaging 0.89
R2043:Olfr610 UTSW 7 103506943 start codon destroyed probably null 0.98
R2254:Olfr610 UTSW 7 103506064 missense probably damaging 1.00
R2566:Olfr610 UTSW 7 103506160 missense probably benign 0.08
R4433:Olfr610 UTSW 7 103506139 missense probably benign 0.04
R5206:Olfr610 UTSW 7 103506102 nonsense probably null
R5470:Olfr610 UTSW 7 103506509 missense probably benign 0.00
R6020:Olfr610 UTSW 7 103506799 missense probably benign
R6848:Olfr610 UTSW 7 103506457 missense possibly damaging 0.50
R7222:Olfr610 UTSW 7 103506457 missense possibly damaging 0.50
R7832:Olfr610 UTSW 7 103506379 missense probably damaging 1.00
R7837:Olfr610 UTSW 7 103506845 missense possibly damaging 0.80
R7893:Olfr610 UTSW 7 103506610 missense possibly damaging 0.86
R7915:Olfr610 UTSW 7 103506379 missense probably damaging 1.00
R7920:Olfr610 UTSW 7 103506845 missense possibly damaging 0.80
R7976:Olfr610 UTSW 7 103506610 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAGCCTTAGGACATCGGGATGAAC -3'
(R):5'- ATTGTCAAGTCTGTGCCCAGCC -3'

Sequencing Primer
(F):5'- ACATCGGGATGAACACAGTATG -3'
(R):5'- GTCGATGGCTGACCTGG -3'
Posted On2014-05-23