Incidental Mutation 'R1752:Cdh16'
ID193625
Institutional Source Beutler Lab
Gene Symbol Cdh16
Ensembl Gene ENSMUSG00000031881
Gene Namecadherin 16
SynonymsKSP-cadherin
MMRRC Submission 039784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1752 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104601911-104624396 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 104619873 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163783] [ENSMUST00000163783] [ENSMUST00000211849] [ENSMUST00000211903] [ENSMUST00000211903] [ENSMUST00000212045] [ENSMUST00000212324] [ENSMUST00000212420] [ENSMUST00000212447] [ENSMUST00000212662] [ENSMUST00000212748] [ENSMUST00000212882] [ENSMUST00000212882] [ENSMUST00000213033]
Predicted Effect probably null
Transcript: ENSMUST00000163783
SMART Domains Protein: ENSMUSP00000129663
Gene: ENSMUSG00000031881

DomainStartEndE-ValueType
CA 47 126 2.42e-9 SMART
CA 150 243 3.93e-9 SMART
CA 260 336 5.52e-13 SMART
CA 360 449 1.33e-15 SMART
CA 474 563 3.35e-1 SMART
CA 585 663 7.88e-1 SMART
transmembrane domain 788 810 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163783
SMART Domains Protein: ENSMUSP00000129663
Gene: ENSMUSG00000031881

DomainStartEndE-ValueType
CA 47 126 2.42e-9 SMART
CA 150 243 3.93e-9 SMART
CA 260 336 5.52e-13 SMART
CA 360 449 1.33e-15 SMART
CA 474 563 3.35e-1 SMART
CA 585 663 7.88e-1 SMART
transmembrane domain 788 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211849
Predicted Effect probably benign
Transcript: ENSMUST00000211889
Predicted Effect probably null
Transcript: ENSMUST00000211903
Predicted Effect probably null
Transcript: ENSMUST00000211903
Predicted Effect probably benign
Transcript: ENSMUST00000212045
Predicted Effect probably benign
Transcript: ENSMUST00000212324
Predicted Effect probably benign
Transcript: ENSMUST00000212420
Predicted Effect probably null
Transcript: ENSMUST00000212447
Predicted Effect probably benign
Transcript: ENSMUST00000212662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212689
Predicted Effect probably benign
Transcript: ENSMUST00000212748
Predicted Effect probably null
Transcript: ENSMUST00000212882
Predicted Effect probably null
Transcript: ENSMUST00000212882
Predicted Effect probably benign
Transcript: ENSMUST00000213033
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Mapped to a previously identified cluster of cadherin genes on chromosome 16q22.1, the gene localizes with superfamily members CDH1, CDH3, CDH5, CDH8 and CDH11. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Accsl C T 2: 93,858,030 G420S probably damaging Het
Adam29 A G 8: 55,872,274 S382P probably damaging Het
Apob T C 12: 7,988,766 L393P probably benign Het
Arhgef19 T G 4: 141,251,043 S616A probably benign Het
Atp11a C T 8: 12,813,094 T91I probably damaging Het
Ccdc88b C T 19: 6,853,322 V751I probably benign Het
Ccni T C 5: 93,202,456 probably benign Het
Cd2 G A 3: 101,276,195 A266V probably benign Het
Cd33 T C 7: 43,532,298 D146G probably benign Het
Chd1 T C 17: 15,743,232 probably null Het
Chd5 A T 4: 152,375,133 I1109F probably damaging Het
Cir1 T C 2: 73,310,538 E29G probably damaging Het
Clec5a T C 6: 40,582,253 T66A probably damaging Het
Cpa2 A G 6: 30,552,024 D250G probably damaging Het
Crybg2 T A 4: 134,073,650 L707H probably damaging Het
Csmd3 T C 15: 47,660,273 T2646A probably benign Het
Cul7 G A 17: 46,653,167 R390Q probably benign Het
Cyp2c69 T A 19: 39,881,153 I141F probably damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Dclk2 C T 3: 86,806,127 V470I possibly damaging Het
Dixdc1 A G 9: 50,682,550 V530A probably benign Het
Dock7 A G 4: 98,966,444 F1528L probably damaging Het
Edn1 T A 13: 42,303,599 V36E possibly damaging Het
Eng T C 2: 32,673,392 V319A probably benign Het
Epb41l2 A G 10: 25,460,792 K229E probably damaging Het
Fam184a T C 10: 53,674,570 N698S probably benign Het
Fam208a T A 14: 27,471,928 Y1028* probably null Het
Fndc7 T C 3: 108,869,330 N465S probably benign Het
Fstl4 T C 11: 53,186,795 V793A probably benign Het
Gm884 T C 11: 103,614,555 T2196A possibly damaging Het
Gm9797 A T 10: 11,609,543 noncoding transcript Het
Hsd17b4 T C 18: 50,170,767 S436P probably benign Het
Itsn2 T G 12: 4,711,950 probably null Het
Kank3 T C 17: 33,819,817 V570A probably damaging Het
Kif13a A T 13: 46,798,409 F733Y probably damaging Het
Kif16b G T 2: 142,690,666 D1184E probably benign Het
Kif20a A G 18: 34,631,581 D727G possibly damaging Het
Kif20b T A 19: 34,938,336 S504R probably benign Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Luzp2 T C 7: 55,264,340 S306P possibly damaging Het
Macf1 T C 4: 123,483,672 I1490V possibly damaging Het
Manba T A 3: 135,506,945 W72R probably damaging Het
Mast1 A G 8: 84,925,336 V339A probably benign Het
Mnx1 A G 5: 29,477,729 S183P unknown Het
Muc5b T G 7: 141,867,751 L4326R possibly damaging Het
Myb T C 10: 21,156,437 D15G possibly damaging Het
Ncapg2 A T 12: 116,426,718 D429V probably damaging Het
Neurod6 A G 6: 55,679,526 V42A probably benign Het
Nfxl1 A T 5: 72,540,875 C276S probably damaging Het
Nptx2 C A 5: 144,555,361 T316N probably damaging Het
Nrp2 T A 1: 62,738,441 F135Y probably damaging Het
Nxpe3 A T 16: 55,866,474 F57Y probably benign Het
Olfr1214 C A 2: 88,987,315 A296S possibly damaging Het
Olfr610 T A 7: 103,506,558 R129S probably benign Het
Osbpl11 T C 16: 33,204,835 Y144H probably damaging Het
Pax5 T C 4: 44,609,729 Y233C probably damaging Het
Pck1 A G 2: 173,157,113 N388S probably benign Het
Plcd3 T A 11: 103,080,259 Q157L probably benign Het
Pnma2 A C 14: 66,916,336 M70L probably benign Het
Pogk T C 1: 166,408,428 K35E probably damaging Het
Ptprb T A 10: 116,340,990 V1227E probably benign Het
Pygm T A 19: 6,391,034 V450E probably damaging Het
Rb1 T A 14: 73,287,624 I190F probably damaging Het
Setd2 T A 9: 110,594,605 Y2243N probably damaging Het
Slc11a2 A T 15: 100,405,806 L182Q probably damaging Het
Slc45a3 T C 1: 131,977,521 L94P probably damaging Het
Slc9a4 T C 1: 40,629,261 F688S probably benign Het
Slit3 A T 11: 35,564,653 I196F probably damaging Het
Sprn G A 7: 140,153,495 probably benign Het
Spsb2 A G 6: 124,810,329 D242G probably benign Het
Srpk2 A G 5: 23,528,019 I111T probably damaging Het
St8sia4 T A 1: 95,591,812 Y317F probably benign Het
Stat5a T A 11: 100,884,058 *798K probably null Het
Sult1c1 C T 17: 53,964,749 V137M possibly damaging Het
Synj1 T C 16: 90,938,473 T1531A probably benign Het
Tax1bp1 A G 6: 52,721,413 T37A probably damaging Het
Tet1 T A 10: 62,812,989 D1888V probably damaging Het
Tln1 T C 4: 43,536,311 T1994A probably damaging Het
Tmco3 A C 8: 13,291,741 D5A probably benign Het
Tnk1 T A 11: 69,856,706 N74I possibly damaging Het
Ttc16 A T 2: 32,772,150 S120T probably damaging Het
Ttn A G 2: 76,764,262 V20480A probably damaging Het
Ttn T A 2: 76,944,104 T2153S probably damaging Het
Usp4 T C 9: 108,374,242 Y539H probably damaging Het
Zar1 A C 5: 72,577,372 V168G probably damaging Het
Zcchc9 T C 13: 91,805,780 K119E possibly damaging Het
Zfp251 T C 15: 76,853,663 N410S possibly damaging Het
Zfp605 A T 5: 110,123,773 D10V probably damaging Het
Zyg11a A T 4: 108,205,282 N107K possibly damaging Het
Other mutations in Cdh16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cdh16 APN 8 104623413 missense probably benign 0.00
IGL01406:Cdh16 APN 8 104618412 missense possibly damaging 0.93
IGL01477:Cdh16 APN 8 104618508 missense probably damaging 0.97
IGL01478:Cdh16 APN 8 104614488 splice site probably benign
IGL01783:Cdh16 APN 8 104617856 missense probably damaging 1.00
IGL01951:Cdh16 APN 8 104617691 missense probably damaging 0.99
IGL02390:Cdh16 APN 8 104621974 missense probably damaging 1.00
IGL02646:Cdh16 APN 8 104622105 critical splice acceptor site probably null
IGL02938:Cdh16 APN 8 104616929 intron probably benign
IGL02961:Cdh16 APN 8 104615205 missense probably damaging 1.00
IGL03378:Cdh16 APN 8 104619285 missense probably benign 0.09
PIT1430001:Cdh16 UTSW 8 104617639 missense probably benign 0.05
R0016:Cdh16 UTSW 8 104617632 missense probably benign 0.22
R1233:Cdh16 UTSW 8 104618482 missense possibly damaging 0.89
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1490:Cdh16 UTSW 8 104622070 missense probably damaging 1.00
R1892:Cdh16 UTSW 8 104617999 missense possibly damaging 0.69
R1913:Cdh16 UTSW 8 104616468 missense probably benign 0.11
R1933:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R1934:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R2029:Cdh16 UTSW 8 104617802 missense probably damaging 1.00
R2057:Cdh16 UTSW 8 104621965 nonsense probably null
R2337:Cdh16 UTSW 8 104622270 missense probably benign 0.09
R3848:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3850:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3892:Cdh16 UTSW 8 104616327 missense probably damaging 1.00
R4167:Cdh16 UTSW 8 104617730 missense probably benign 0.02
R4577:Cdh16 UTSW 8 104618559 missense probably damaging 1.00
R4657:Cdh16 UTSW 8 104615226 unclassified probably null
R4726:Cdh16 UTSW 8 104616032 missense probably damaging 0.97
R4843:Cdh16 UTSW 8 104621540 missense probably damaging 1.00
R4878:Cdh16 UTSW 8 104618064 missense probably damaging 1.00
R5013:Cdh16 UTSW 8 104617028 missense probably damaging 1.00
R5642:Cdh16 UTSW 8 104618045 missense probably damaging 0.98
R6134:Cdh16 UTSW 8 104616065 missense probably benign 0.15
R6311:Cdh16 UTSW 8 104614433 missense probably benign 0.40
R6352:Cdh16 UTSW 8 104616992 missense probably damaging 0.99
R6382:Cdh16 UTSW 8 104621543 missense possibly damaging 0.78
R6713:Cdh16 UTSW 8 104619985 nonsense probably null
R6732:Cdh16 UTSW 8 104618533 missense probably benign 0.28
R6755:Cdh16 UTSW 8 104619248 missense probably damaging 1.00
R6913:Cdh16 UTSW 8 104622264 missense probably benign 0.00
R7037:Cdh16 UTSW 8 104617635 nonsense probably null
R7202:Cdh16 UTSW 8 104614148 missense unknown
R7413:Cdh16 UTSW 8 104619940 missense probably benign 0.00
R7460:Cdh16 UTSW 8 104622291 missense possibly damaging 0.88
RF005:Cdh16 UTSW 8 104617052 missense probably damaging 1.00
RF024:Cdh16 UTSW 8 104617052 missense probably damaging 1.00
X0067:Cdh16 UTSW 8 104620017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAATCCCCAATGGCAGTGAAAG -3'
(R):5'- GACCATGCCCTTGAAGAGACTTACC -3'

Sequencing Primer
(F):5'- GGATGTTAGAGCACAAACTCAC -3'
(R):5'- GACTTACCAGCTATTGGTACAGG -3'
Posted On2014-05-23