Incidental Mutation 'R1752:Kif13a'
ID193652
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Namekinesin family member 13A
Synonyms4930505I07Rik, N-3 kinesin
MMRRC Submission 039784-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R1752 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location46749087-46929867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46798409 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 733 (F733Y)
Ref Sequence ENSEMBL: ENSMUSP00000153614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]
Predicted Effect probably damaging
Transcript: ENSMUST00000056978
AA Change: F796Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: F796Y

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225591
AA Change: F733Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225904
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Accsl C T 2: 93,858,030 G420S probably damaging Het
Adam29 A G 8: 55,872,274 S382P probably damaging Het
Apob T C 12: 7,988,766 L393P probably benign Het
Arhgef19 T G 4: 141,251,043 S616A probably benign Het
Atp11a C T 8: 12,813,094 T91I probably damaging Het
Ccdc88b C T 19: 6,853,322 V751I probably benign Het
Ccni T C 5: 93,202,456 probably benign Het
Cd2 G A 3: 101,276,195 A266V probably benign Het
Cd33 T C 7: 43,532,298 D146G probably benign Het
Cdh16 A G 8: 104,619,873 probably null Het
Chd1 T C 17: 15,743,232 probably null Het
Chd5 A T 4: 152,375,133 I1109F probably damaging Het
Cir1 T C 2: 73,310,538 E29G probably damaging Het
Clec5a T C 6: 40,582,253 T66A probably damaging Het
Cpa2 A G 6: 30,552,024 D250G probably damaging Het
Crybg2 T A 4: 134,073,650 L707H probably damaging Het
Csmd3 T C 15: 47,660,273 T2646A probably benign Het
Cul7 G A 17: 46,653,167 R390Q probably benign Het
Cyp2c69 T A 19: 39,881,153 I141F probably damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Dclk2 C T 3: 86,806,127 V470I possibly damaging Het
Dixdc1 A G 9: 50,682,550 V530A probably benign Het
Dock7 A G 4: 98,966,444 F1528L probably damaging Het
Edn1 T A 13: 42,303,599 V36E possibly damaging Het
Eng T C 2: 32,673,392 V319A probably benign Het
Epb41l2 A G 10: 25,460,792 K229E probably damaging Het
Fam184a T C 10: 53,674,570 N698S probably benign Het
Fam208a T A 14: 27,471,928 Y1028* probably null Het
Fndc7 T C 3: 108,869,330 N465S probably benign Het
Fstl4 T C 11: 53,186,795 V793A probably benign Het
Gm884 T C 11: 103,614,555 T2196A possibly damaging Het
Gm9797 A T 10: 11,609,543 noncoding transcript Het
Hsd17b4 T C 18: 50,170,767 S436P probably benign Het
Itsn2 T G 12: 4,711,950 probably null Het
Kank3 T C 17: 33,819,817 V570A probably damaging Het
Kif16b G T 2: 142,690,666 D1184E probably benign Het
Kif20a A G 18: 34,631,581 D727G possibly damaging Het
Kif20b T A 19: 34,938,336 S504R probably benign Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Luzp2 T C 7: 55,264,340 S306P possibly damaging Het
Macf1 T C 4: 123,483,672 I1490V possibly damaging Het
Manba T A 3: 135,506,945 W72R probably damaging Het
Mast1 A G 8: 84,925,336 V339A probably benign Het
Mnx1 A G 5: 29,477,729 S183P unknown Het
Muc5b T G 7: 141,867,751 L4326R possibly damaging Het
Myb T C 10: 21,156,437 D15G possibly damaging Het
Ncapg2 A T 12: 116,426,718 D429V probably damaging Het
Neurod6 A G 6: 55,679,526 V42A probably benign Het
Nfxl1 A T 5: 72,540,875 C276S probably damaging Het
Nptx2 C A 5: 144,555,361 T316N probably damaging Het
Nrp2 T A 1: 62,738,441 F135Y probably damaging Het
Nxpe3 A T 16: 55,866,474 F57Y probably benign Het
Olfr1214 C A 2: 88,987,315 A296S possibly damaging Het
Olfr610 T A 7: 103,506,558 R129S probably benign Het
Osbpl11 T C 16: 33,204,835 Y144H probably damaging Het
Pax5 T C 4: 44,609,729 Y233C probably damaging Het
Pck1 A G 2: 173,157,113 N388S probably benign Het
Plcd3 T A 11: 103,080,259 Q157L probably benign Het
Pnma2 A C 14: 66,916,336 M70L probably benign Het
Pogk T C 1: 166,408,428 K35E probably damaging Het
Ptprb T A 10: 116,340,990 V1227E probably benign Het
Pygm T A 19: 6,391,034 V450E probably damaging Het
Rb1 T A 14: 73,287,624 I190F probably damaging Het
Setd2 T A 9: 110,594,605 Y2243N probably damaging Het
Slc11a2 A T 15: 100,405,806 L182Q probably damaging Het
Slc45a3 T C 1: 131,977,521 L94P probably damaging Het
Slc9a4 T C 1: 40,629,261 F688S probably benign Het
Slit3 A T 11: 35,564,653 I196F probably damaging Het
Sprn G A 7: 140,153,495 probably benign Het
Spsb2 A G 6: 124,810,329 D242G probably benign Het
Srpk2 A G 5: 23,528,019 I111T probably damaging Het
St8sia4 T A 1: 95,591,812 Y317F probably benign Het
Stat5a T A 11: 100,884,058 *798K probably null Het
Sult1c1 C T 17: 53,964,749 V137M possibly damaging Het
Synj1 T C 16: 90,938,473 T1531A probably benign Het
Tax1bp1 A G 6: 52,721,413 T37A probably damaging Het
Tet1 T A 10: 62,812,989 D1888V probably damaging Het
Tln1 T C 4: 43,536,311 T1994A probably damaging Het
Tmco3 A C 8: 13,291,741 D5A probably benign Het
Tnk1 T A 11: 69,856,706 N74I possibly damaging Het
Ttc16 A T 2: 32,772,150 S120T probably damaging Het
Ttn A G 2: 76,764,262 V20480A probably damaging Het
Ttn T A 2: 76,944,104 T2153S probably damaging Het
Usp4 T C 9: 108,374,242 Y539H probably damaging Het
Zar1 A C 5: 72,577,372 V168G probably damaging Het
Zcchc9 T C 13: 91,805,780 K119E possibly damaging Het
Zfp251 T C 15: 76,853,663 N410S possibly damaging Het
Zfp605 A T 5: 110,123,773 D10V probably damaging Het
Zyg11a A T 4: 108,205,282 N107K possibly damaging Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46750634 splice site probably benign
IGL01433:Kif13a APN 13 46772908 missense probably damaging 1.00
IGL01528:Kif13a APN 13 46864837 splice site probably benign
IGL01536:Kif13a APN 13 46752289 missense probably damaging 0.96
IGL01620:Kif13a APN 13 46864820 missense probably benign
IGL02020:Kif13a APN 13 46794019 missense probably benign 0.05
IGL02142:Kif13a APN 13 46771535 missense probably benign 0.04
IGL02375:Kif13a APN 13 46825222 missense probably damaging 1.00
IGL02407:Kif13a APN 13 46785293 missense probably damaging 0.99
IGL02476:Kif13a APN 13 46785296 missense probably damaging 1.00
IGL03038:Kif13a APN 13 46772838 missense probably damaging 1.00
IGL03053:Kif13a APN 13 46752088 missense probably benign 0.01
IGL03366:Kif13a APN 13 46764623 missense probably benign 0.00
R0025:Kif13a UTSW 13 46786511 critical splice donor site probably null
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0135:Kif13a UTSW 13 46793943 missense probably damaging 0.99
R0137:Kif13a UTSW 13 46764603 missense probably benign 0.38
R0243:Kif13a UTSW 13 46791351 missense probably benign 0.24
R0346:Kif13a UTSW 13 46814219 missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46791401 missense probably damaging 1.00
R0492:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46802711 missense probably damaging 0.96
R0631:Kif13a UTSW 13 46778888 unclassified probably benign
R0654:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0697:Kif13a UTSW 13 46848337 missense probably benign 0.19
R0699:Kif13a UTSW 13 46799213 missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46812823 missense probably damaging 0.98
R0834:Kif13a UTSW 13 46814236 missense probably damaging 0.96
R0903:Kif13a UTSW 13 46929259 missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46825235 missense probably damaging 1.00
R1428:Kif13a UTSW 13 46791511 splice site probably benign
R1449:Kif13a UTSW 13 46812736 missense probably damaging 1.00
R1463:Kif13a UTSW 13 46929612 missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46809213 missense probably benign
R1579:Kif13a UTSW 13 46752856 missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46793922 missense probably benign 0.03
R1644:Kif13a UTSW 13 46793922 missense probably benign 0.31
R1755:Kif13a UTSW 13 46752613 missense possibly damaging 0.73
R1755:Kif13a UTSW 13 46773678 missense possibly damaging 0.50
R1858:Kif13a UTSW 13 46864838 splice site probably benign
R1891:Kif13a UTSW 13 46929219 missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46788162 missense probably benign 0.00
R1928:Kif13a UTSW 13 46812745 missense probably damaging 1.00
R1960:Kif13a UTSW 13 46864838 splice site probably benign
R1961:Kif13a UTSW 13 46864838 splice site probably benign
R2016:Kif13a UTSW 13 46810799 missense probably benign 0.13
R2139:Kif13a UTSW 13 46752469 missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46769176 missense probably damaging 0.99
R2407:Kif13a UTSW 13 46777097 missense probably damaging 1.00
R2504:Kif13a UTSW 13 46814200 missense probably damaging 1.00
R3122:Kif13a UTSW 13 46764596 splice site probably benign
R3499:Kif13a UTSW 13 46825339 missense probably damaging 1.00
R3905:Kif13a UTSW 13 46802690 missense probably damaging 1.00
R4474:Kif13a UTSW 13 46814155 splice site probably null
R4771:Kif13a UTSW 13 46825211 missense probably damaging 1.00
R4838:Kif13a UTSW 13 46826748 missense probably damaging 1.00
R4924:Kif13a UTSW 13 46929599 missense probably damaging 1.00
R4931:Kif13a UTSW 13 46809055 missense probably damaging 0.96
R4980:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46777163 missense probably damaging 0.96
R5047:Kif13a UTSW 13 46788085 missense probably benign 0.00
R5054:Kif13a UTSW 13 46802646 missense probably damaging 1.00
R5141:Kif13a UTSW 13 46752721 missense probably benign
R5329:Kif13a UTSW 13 46775401 critical splice donor site probably null
R5429:Kif13a UTSW 13 46772769 critical splice donor site probably null
R5499:Kif13a UTSW 13 46832736 missense probably damaging 1.00
R5509:Kif13a UTSW 13 46752115 missense probably benign 0.13
R5594:Kif13a UTSW 13 46752862 missense probably damaging 1.00
R5921:Kif13a UTSW 13 46825300 missense probably damaging 1.00
R5964:Kif13a UTSW 13 46771524 missense probably damaging 1.00
R6115:Kif13a UTSW 13 46801313 missense probably damaging 1.00
R6317:Kif13a UTSW 13 46826757 missense probably damaging 1.00
R6318:Kif13a UTSW 13 46815207 splice site probably null
R6393:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46809156 critical splice donor site probably null
R7285:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7341:Kif13a UTSW 13 46826745 missense probably damaging 1.00
R7693:Kif13a UTSW 13 46750613 missense probably benign 0.01
R7761:Kif13a UTSW 13 46798479 missense probably benign
R8098:Kif13a UTSW 13 46815304 missense probably damaging 1.00
R8171:Kif13a UTSW 13 46778968 missense probably damaging 1.00
R8271:Kif13a UTSW 13 46752581 missense probably benign 0.01
X0013:Kif13a UTSW 13 46929270 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCTATGATCCAGGAAGGAACTGGCG -3'
(R):5'- TGGTGTAAGTCACAGGGCATGACG -3'

Sequencing Primer
(F):5'- CAacacacacacacacacac -3'
(R):5'- GGCACGATTCTGATTGCAC -3'
Posted On2014-05-23