Incidental Mutation 'R1752:Rb1'
ID193656
Institutional Source Beutler Lab
Gene Symbol Rb1
Ensembl Gene ENSMUSG00000022105
Gene NameRB transcriptional corepressor 1
SynonymsRb-1, Rb, pRb
MMRRC Submission 039784-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1752 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location73183673-73325822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73287624 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 190 (I190F)
Ref Sequence ENSEMBL: ENSMUSP00000022701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701] [ENSMUST00000164624]
Predicted Effect probably damaging
Transcript: ENSMUST00000022701
AA Change: I190F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105
AA Change: I190F

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163932
Predicted Effect probably benign
Transcript: ENSMUST00000164624
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Accsl C T 2: 93,858,030 G420S probably damaging Het
Adam29 A G 8: 55,872,274 S382P probably damaging Het
Apob T C 12: 7,988,766 L393P probably benign Het
Arhgef19 T G 4: 141,251,043 S616A probably benign Het
Atp11a C T 8: 12,813,094 T91I probably damaging Het
Ccdc88b C T 19: 6,853,322 V751I probably benign Het
Ccni T C 5: 93,202,456 probably benign Het
Cd2 G A 3: 101,276,195 A266V probably benign Het
Cd33 T C 7: 43,532,298 D146G probably benign Het
Cdh16 A G 8: 104,619,873 probably null Het
Chd1 T C 17: 15,743,232 probably null Het
Chd5 A T 4: 152,375,133 I1109F probably damaging Het
Cir1 T C 2: 73,310,538 E29G probably damaging Het
Clec5a T C 6: 40,582,253 T66A probably damaging Het
Cpa2 A G 6: 30,552,024 D250G probably damaging Het
Crybg2 T A 4: 134,073,650 L707H probably damaging Het
Csmd3 T C 15: 47,660,273 T2646A probably benign Het
Cul7 G A 17: 46,653,167 R390Q probably benign Het
Cyp2c69 T A 19: 39,881,153 I141F probably damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Dclk2 C T 3: 86,806,127 V470I possibly damaging Het
Dixdc1 A G 9: 50,682,550 V530A probably benign Het
Dock7 A G 4: 98,966,444 F1528L probably damaging Het
Edn1 T A 13: 42,303,599 V36E possibly damaging Het
Eng T C 2: 32,673,392 V319A probably benign Het
Epb41l2 A G 10: 25,460,792 K229E probably damaging Het
Fam184a T C 10: 53,674,570 N698S probably benign Het
Fam208a T A 14: 27,471,928 Y1028* probably null Het
Fndc7 T C 3: 108,869,330 N465S probably benign Het
Fstl4 T C 11: 53,186,795 V793A probably benign Het
Gm884 T C 11: 103,614,555 T2196A possibly damaging Het
Gm9797 A T 10: 11,609,543 noncoding transcript Het
Hsd17b4 T C 18: 50,170,767 S436P probably benign Het
Itsn2 T G 12: 4,711,950 probably null Het
Kank3 T C 17: 33,819,817 V570A probably damaging Het
Kif13a A T 13: 46,798,409 F733Y probably damaging Het
Kif16b G T 2: 142,690,666 D1184E probably benign Het
Kif20a A G 18: 34,631,581 D727G possibly damaging Het
Kif20b T A 19: 34,938,336 S504R probably benign Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Luzp2 T C 7: 55,264,340 S306P possibly damaging Het
Macf1 T C 4: 123,483,672 I1490V possibly damaging Het
Manba T A 3: 135,506,945 W72R probably damaging Het
Mast1 A G 8: 84,925,336 V339A probably benign Het
Mnx1 A G 5: 29,477,729 S183P unknown Het
Muc5b T G 7: 141,867,751 L4326R possibly damaging Het
Myb T C 10: 21,156,437 D15G possibly damaging Het
Ncapg2 A T 12: 116,426,718 D429V probably damaging Het
Neurod6 A G 6: 55,679,526 V42A probably benign Het
Nfxl1 A T 5: 72,540,875 C276S probably damaging Het
Nptx2 C A 5: 144,555,361 T316N probably damaging Het
Nrp2 T A 1: 62,738,441 F135Y probably damaging Het
Nxpe3 A T 16: 55,866,474 F57Y probably benign Het
Olfr1214 C A 2: 88,987,315 A296S possibly damaging Het
Olfr610 T A 7: 103,506,558 R129S probably benign Het
Osbpl11 T C 16: 33,204,835 Y144H probably damaging Het
Pax5 T C 4: 44,609,729 Y233C probably damaging Het
Pck1 A G 2: 173,157,113 N388S probably benign Het
Plcd3 T A 11: 103,080,259 Q157L probably benign Het
Pnma2 A C 14: 66,916,336 M70L probably benign Het
Pogk T C 1: 166,408,428 K35E probably damaging Het
Ptprb T A 10: 116,340,990 V1227E probably benign Het
Pygm T A 19: 6,391,034 V450E probably damaging Het
Setd2 T A 9: 110,594,605 Y2243N probably damaging Het
Slc11a2 A T 15: 100,405,806 L182Q probably damaging Het
Slc45a3 T C 1: 131,977,521 L94P probably damaging Het
Slc9a4 T C 1: 40,629,261 F688S probably benign Het
Slit3 A T 11: 35,564,653 I196F probably damaging Het
Sprn G A 7: 140,153,495 probably benign Het
Spsb2 A G 6: 124,810,329 D242G probably benign Het
Srpk2 A G 5: 23,528,019 I111T probably damaging Het
St8sia4 T A 1: 95,591,812 Y317F probably benign Het
Stat5a T A 11: 100,884,058 *798K probably null Het
Sult1c1 C T 17: 53,964,749 V137M possibly damaging Het
Synj1 T C 16: 90,938,473 T1531A probably benign Het
Tax1bp1 A G 6: 52,721,413 T37A probably damaging Het
Tet1 T A 10: 62,812,989 D1888V probably damaging Het
Tln1 T C 4: 43,536,311 T1994A probably damaging Het
Tmco3 A C 8: 13,291,741 D5A probably benign Het
Tnk1 T A 11: 69,856,706 N74I possibly damaging Het
Ttc16 A T 2: 32,772,150 S120T probably damaging Het
Ttn A G 2: 76,764,262 V20480A probably damaging Het
Ttn T A 2: 76,944,104 T2153S probably damaging Het
Usp4 T C 9: 108,374,242 Y539H probably damaging Het
Zar1 A C 5: 72,577,372 V168G probably damaging Het
Zcchc9 T C 13: 91,805,780 K119E possibly damaging Het
Zfp251 T C 15: 76,853,663 N410S possibly damaging Het
Zfp605 A T 5: 110,123,773 D10V probably damaging Het
Zyg11a A T 4: 108,205,282 N107K possibly damaging Het
Other mutations in Rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Rb1 APN 14 73264598 missense probably damaging 1.00
IGL00951:Rb1 APN 14 73322072 missense probably damaging 1.00
IGL01152:Rb1 APN 14 73205870 missense probably damaging 1.00
IGL01339:Rb1 APN 14 73264371 critical splice acceptor site probably null
IGL01349:Rb1 APN 14 73269118 missense probably damaging 1.00
IGL01390:Rb1 APN 14 73294999 missense probably benign 0.02
IGL02066:Rb1 APN 14 73198534 missense probably benign 0.06
IGL02207:Rb1 APN 14 73206085 missense probably damaging 1.00
IGL02860:Rb1 APN 14 73206012 missense probably damaging 1.00
IGL03370:Rb1 APN 14 73282866 critical splice donor site probably null
rubidium UTSW 14 73199311 missense probably damaging 1.00
P0028:Rb1 UTSW 14 73264628 missense probably damaging 1.00
R0553:Rb1 UTSW 14 73211712 nonsense probably null
R0563:Rb1 UTSW 14 73216767 missense probably damaging 1.00
R0586:Rb1 UTSW 14 73287684 intron probably benign
R0595:Rb1 UTSW 14 73273680 missense probably damaging 1.00
R0755:Rb1 UTSW 14 73197213 makesense probably null
R1480:Rb1 UTSW 14 73262602 missense probably benign
R1513:Rb1 UTSW 14 73322084 missense probably benign 0.00
R1919:Rb1 UTSW 14 73212990 nonsense probably null
R2010:Rb1 UTSW 14 73294993 missense probably benign 0.16
R2087:Rb1 UTSW 14 73280252 missense probably benign 0.09
R2152:Rb1 UTSW 14 73288725 missense probably benign
R2167:Rb1 UTSW 14 73211651 missense probably damaging 1.00
R3950:Rb1 UTSW 14 73262662 missense probably damaging 1.00
R4183:Rb1 UTSW 14 73198526 splice site probably null
R4225:Rb1 UTSW 14 73269191 missense possibly damaging 0.58
R4306:Rb1 UTSW 14 73262695 missense probably damaging 1.00
R4464:Rb1 UTSW 14 73199198 intron probably null
R4609:Rb1 UTSW 14 73262514 splice site probably benign
R4671:Rb1 UTSW 14 73273676 missense probably damaging 1.00
R4916:Rb1 UTSW 14 73216691 missense probably damaging 1.00
R5160:Rb1 UTSW 14 73264455 synonymous silent
R5210:Rb1 UTSW 14 73199311 missense probably damaging 1.00
R5320:Rb1 UTSW 14 73213126 nonsense probably null
R5436:Rb1 UTSW 14 73213140 splice site probably null
R5467:Rb1 UTSW 14 73211620 missense possibly damaging 0.92
R5592:Rb1 UTSW 14 73211747 missense probably damaging 1.00
R6326:Rb1 UTSW 14 73198534 missense probably benign 0.06
R6363:Rb1 UTSW 14 73287641 missense probably benign 0.01
R6395:Rb1 UTSW 14 73199196 missense probably damaging 1.00
R6414:Rb1 UTSW 14 73282974 missense unknown
R6460:Rb1 UTSW 14 73278454 missense probably benign 0.06
R6503:Rb1 UTSW 14 73205880 missense probably benign 0.08
R6519:Rb1 UTSW 14 73298063 missense probably benign 0.00
R6671:Rb1 UTSW 14 73197266 missense probably damaging 1.00
R7026:Rb1 UTSW 14 73298099 missense probably benign 0.00
R7103:Rb1 UTSW 14 73262644 missense probably damaging 1.00
R7263:Rb1 UTSW 14 73282923 nonsense probably null
R7478:Rb1 UTSW 14 73269137 missense probably damaging 1.00
R7519:Rb1 UTSW 14 73264608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCTGACTTTTATCCCCAACAC -3'
(R):5'- ATTTCCTGCCCCACGAAAGCACTG -3'

Sequencing Primer
(F):5'- GGAGGAATTAAACATTTCGAATGATG -3'
(R):5'- GCTGGAATACTTTGTCAGTGTC -3'
Posted On2014-05-23