Mutagenetix > Incidental Mutation

Incidental Mutation 'R1753:Dnah7b'

193680

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

Dnahc7b, LOC227058

MMRRC Submission

039785-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R1753 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46066315-46373546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46322335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 3465 (F3465S)

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069293
AA Change: F3465S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: F3465S

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185557

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	T	11: 109,973,716	F409I	probably benign	Het
Adamts19	A	C	18: 59,007,372	I848L	possibly damaging	Het
Adamts5	T	C	16: 85,899,352	S306G	probably damaging	Het
Adamts8	T	G	9: 30,954,614	I486S	probably benign	Het
Adgrg5	T	C	8: 94,942,052	F499L	possibly damaging	Het
Akr1c21	T	A	13: 4,577,135	C145*	probably null	Het
Anp32b	T	G	4: 46,460,241		probably null	Het
Arhgap31	A	G	16: 38,601,612	V1364A	possibly damaging	Het
C2cd6	T	C	1: 59,094,833	R10G	possibly damaging	Het
Cacna2d1	A	G	5: 16,302,354	E367G	possibly damaging	Het
Ccdc81	C	T	7: 89,866,561	E637K	probably benign	Het
Cd2	A	T	3: 101,287,499	M91K	possibly damaging	Het
Cdc16	C	A	8: 13,764,688	Y157*	probably null	Het
Celsr3	G	T	9: 108,831,857	V1301F	probably damaging	Het
Cep164	C	T	9: 45,792,937	G961S	probably damaging	Het
Cep290	T	C	10: 100,513,981	V630A	probably benign	Het
Chd5	C	T	4: 152,378,815	S1451F	probably damaging	Het
Cldn23	A	C	8: 35,825,986	L116R	possibly damaging	Het
Cngb1	A	T	8: 95,297,773		probably benign	Het
Cpb1	G	T	3: 20,266,241	N151K	possibly damaging	Het
Cpn2	A	G	16: 30,260,100	F261S	probably damaging	Het
Crlf3	A	C	11: 80,057,872	V249G	probably damaging	Het
Csmd1	A	T	8: 16,157,120	Y1298*	probably null	Het
Cstf2t	C	A	19: 31,083,685	P207Q	possibly damaging	Het
Cym	A	C	3: 107,213,425	L288R	possibly damaging	Het
Cyp2j12	C	T	4: 96,121,432		probably null	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dnmt3a	A	T	12: 3,873,342	M181L	possibly damaging	Het
Duox1	T	A	2: 122,333,429	M859K	probably damaging	Het
Eif2b4	A	T	5: 31,192,940	S13T	probably benign	Het
Ercc6	T	C	14: 32,576,999	V1448A	probably benign	Het
Esp24	A	G	17: 39,040,002	E31G	possibly damaging	Het
F2rl2	T	A	13: 95,701,461	M338K	probably benign	Het
Fgfbp1	A	C	5: 43,979,923	L9R	possibly damaging	Het
Gal3st2b	A	T	1: 93,940,616	N188Y	probably damaging	Het
Gpr179	G	C	11: 97,346,578	C372W	probably damaging	Het
Grn	T	G	11: 102,433,267	C61G	probably damaging	Het
Herc1	T	G	9: 66,469,010	C3371G	probably damaging	Het
Herc1	T	C	9: 66,502,084		probably null	Het
Hmcn1	C	T	1: 150,586,468	G5153D	possibly damaging	Het
Ifi35	A	T	11: 101,456,635	R31W	probably damaging	Het
Ifit1bl1	T	A	19: 34,593,860	H399L	probably benign	Het
Irx3	G	A	8: 91,800,734	P114L	probably damaging	Het
Kat6a	T	A	8: 22,935,797	D1119E	probably benign	Het
Kmt2d	G	T	15: 98,843,482		probably benign	Het
Kng1	A	T	16: 23,079,119	H423L	possibly damaging	Het
Lrp2	T	A	2: 69,496,489	Q1746L	possibly damaging	Het
Lrrc29	A	T	8: 105,313,192	V517E	probably damaging	Het
Lrrc63	A	T	14: 75,086,344		probably null	Het
Mad2l1	T	A	6: 66,539,813	V163E	possibly damaging	Het
Map3k19	A	G	1: 127,822,680	M978T	probably benign	Het
Mon1a	A	C	9: 107,901,363	N262T	probably damaging	Het
Mpo	A	G	11: 87,795,881	N85D	probably benign	Het
Mpp4	T	C	1: 59,144,810	D244G	probably null	Het
Mstn	A	G	1: 53,066,558	Y353C	probably damaging	Het
Mx1	T	A	16: 97,454,158	N232Y	probably damaging	Het
Mycs	T	C	X: 5,468,103	R308G	probably benign	Het
Myh11	A	T	16: 14,277,870	D9E	probably benign	Het
Nfe2l3	A	T	6: 51,433,412	Q169L	probably null	Het
Nr5a1	G	T	2: 38,708,419	T122N	possibly damaging	Het
Nras	A	G	3: 103,058,979	T20A	probably damaging	Het
Obp2b	T	A	2: 25,738,640		probably null	Het
Olfr1109	T	C	2: 87,093,227	T57A	probably damaging	Het
Olfr1143	T	A	2: 87,802,762	F124L	probably benign	Het
Olfr1410	G	A	1: 92,608,400	V188M	probably benign	Het
Olfr365	A	G	2: 37,201,427	Y62C	probably damaging	Het
Olfr577	T	C	7: 102,973,056	N312S	probably benign	Het
Pcdh17	A	T	14: 84,477,654	T920S	probably benign	Het
Pcdh9	T	C	14: 93,887,225	D503G	probably benign	Het
Pcdhb12	C	T	18: 37,436,671	T290I	probably damaging	Het
Pde6b	C	A	5: 108,388,691	C84*	probably null	Het
Pex1	A	T	5: 3,630,044	N914I	probably damaging	Het
Pign	A	G	1: 105,589,317	V528A	possibly damaging	Het
Pkhd1	T	G	1: 20,533,905	D1187A	possibly damaging	Het
Ppip5k1	T	C	2: 121,342,631	K489E	probably damaging	Het
Prob1	T	C	18: 35,653,252	T650A	possibly damaging	Het
Radil	T	C	5: 142,495,336	Y572C	probably damaging	Het
Rapgef2	A	G	3: 79,088,791	I555T	possibly damaging	Het
Rgs5	G	A	1: 169,682,817		probably null	Het
Rnaset2b	G	A	17: 6,981,107		probably null	Het
S1pr1	A	G	3: 115,711,938	S336P	probably benign	Het
Slc24a5	A	G	2: 125,083,195	E252G	possibly damaging	Het
Slc34a2	A	T	5: 53,061,391	I184F	probably benign	Het
Slc35a3	A	G	3: 116,677,948	V224A	possibly damaging	Het
Slc39a9	A	G	12: 80,677,202	H211R	probably damaging	Het
Slu7	A	G	11: 43,439,268	N174S	probably benign	Het
Smarcd3	A	T	5: 24,595,822	Y131*	probably null	Het
Syne1	A	G	10: 5,367,621	M491T	probably benign	Het
Tars	G	A	15: 11,394,243	Q103*	probably null	Het
Tmem132d	C	A	5: 127,789,855	E660D	probably benign	Het
Ttn	T	C	2: 76,745,043	T16842A	probably damaging	Het
Ttn	T	A	2: 76,752,261	M22763L	probably benign	Het
Ttn	T	C	2: 76,812,972	E13201G	probably damaging	Het
Ubp1	A	T	9: 113,955,969	I117L	possibly damaging	Het
Usp24	T	A	4: 106,377,559	H954Q	probably benign	Het
Vmn1r174	G	A	7: 23,754,197	R96H	probably benign	Het
Vmn2r63	G	A	7: 42,928,245	Q290*	probably null	Het
Vnn3	T	C	10: 23,865,820	I341T	probably benign	Het
Wbp2nl	A	G	15: 82,305,744	T46A	probably damaging	Het
Wdr48	G	T	9: 119,924,247	E625*	probably null	Het
Wdr6	C	T	9: 108,575,164	V507I	probably damaging	Het
Zp2	A	T	7: 120,138,105	W287R	probably benign	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46142149	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46211337	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46224651	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46066729	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46214322	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46195378	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46081432	splice site	probably benign
IGL01392:Dnah7b	APN	1	46126788	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46116300	splice site	probably benign
IGL01460:Dnah7b	APN	1	46139704	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46268653	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46358147	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46358137	nonsense	probably null
IGL01906:Dnah7b	APN	1	46175453	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46124337	splice site	probably benign
IGL01989:Dnah7b	APN	1	46289534	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46139875	missense	probably benign
IGL02213:Dnah7b	APN	1	46233592	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46226930	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46099503	nonsense	probably null
IGL02381:Dnah7b	APN	1	46277120	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46234193	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46195318	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46123777	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46116301	splice site	probably benign
IGL02704:Dnah7b	APN	1	46142133	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46099608	splice site	probably benign
IGL02745:Dnah7b	APN	1	46195029	splice site	probably benign
IGL02818:Dnah7b	APN	1	46290808	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46119298	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46182375	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46085689	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46119304	missense	probably benign	0.18
BB001:Dnah7b	UTSW	1	46219430	missense	probably benign	0.04
BB011:Dnah7b	UTSW	1	46219430	missense	probably benign	0.04
PIT4305001:Dnah7b	UTSW	1	46373348	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46213360	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46223178	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46219348	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46123777	missense	probably benign	0.26
R0313:Dnah7b	UTSW	1	46207643	missense	probably damaging	1.00
R0317:Dnah7b	UTSW	1	46134656	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46240944	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46277126	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46236788	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46140176	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46219544	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46324842	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46240992	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46324842	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46340132	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46099612	splice site	probably benign
R1035:Dnah7b	UTSW	1	46124448	missense	probably benign
R1147:Dnah7b	UTSW	1	46340266	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46340266	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46325810	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46340120	missense	probably benign	0.00
R1318:Dnah7b	UTSW	1	46099509	missense	possibly damaging	0.80
R1334:Dnah7b	UTSW	1	46322335	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46289656	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46078593	splice site	probably benign
R1484:Dnah7b	UTSW	1	46137543	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46177281	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46066797	missense	unknown
R1607:Dnah7b	UTSW	1	46290646	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46352966	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46175390	nonsense	probably null
R1681:Dnah7b	UTSW	1	46324712	nonsense	probably null
R1716:Dnah7b	UTSW	1	46191783	missense	probably damaging	1.00
R1834:Dnah7b	UTSW	1	46233759	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46116177	missense	probably benign	0.04
R1838:Dnah7b	UTSW	1	46277105	missense	probably damaging	1.00
R1898:Dnah7b	UTSW	1	46236714	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46242103	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46142087	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46242321	nonsense	probably null
R2083:Dnah7b	UTSW	1	46241067	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46097992	splice site	probably benign
R2172:Dnah7b	UTSW	1	46124512	missense	probably benign	0.12
R2239:Dnah7b	UTSW	1	46201184	splice site	probably benign
R2247:Dnah7b	UTSW	1	46277063	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46233915	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46362954	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46195287	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46139741	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46207572	missense	probably damaging	1.00
R3013:Dnah7b	UTSW	1	46188687	critical splice donor site	probably null
R3022:Dnah7b	UTSW	1	46182423	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46268709	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46352873	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46299875	missense	probably benign	0.05
R3898:Dnah7b	UTSW	1	46243257	missense	probably damaging	1.00
R3944:Dnah7b	UTSW	1	46137485	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46233711	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46081495	missense	probably benign
R4172:Dnah7b	UTSW	1	46226946	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46137418	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46221772	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46337594	splice site	probably null
R4414:Dnah7b	UTSW	1	46126680	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46085632	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46289536	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46078524	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46217157	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46211328	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46207656	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46066955	missense	unknown
R4780:Dnah7b	UTSW	1	46353014	missense	probably benign
R4828:Dnah7b	UTSW	1	46128112	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46356602	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46195074	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46081444	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46201318	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46290775	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46233726	missense	probably benign
R5000:Dnah7b	UTSW	1	46099503	nonsense	probably null
R5005:Dnah7b	UTSW	1	46242028	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46187363	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46182380	nonsense	probably null
R5174:Dnah7b	UTSW	1	46243349	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46358216	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46233858	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46373354	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46233689	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46217191	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46188659	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46358271	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46242206	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46242019	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46109312	missense	probably null
R5479:Dnah7b	UTSW	1	46223105	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46242199	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46356514	missense	possibly damaging	0.95
R5641:Dnah7b	UTSW	1	46268764	splice site	probably null
R5659:Dnah7b	UTSW	1	46352849	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46233992	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46277120	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46142132	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46191725	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46337593	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46221643	missense	probably benign
R5941:Dnah7b	UTSW	1	46187290	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46362987	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46119398	splice site	probably null
R6041:Dnah7b	UTSW	1	46289645	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46139789	missense	probably benign
R6049:Dnah7b	UTSW	1	46085602	missense	probably benign
R6131:Dnah7b	UTSW	1	46253466	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46290703	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46204269	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46233585	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46126668	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46204269	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46225888	missense	probably benign
R6273:Dnah7b	UTSW	1	46242316	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46325886	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46325886	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46340175	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46242204	nonsense	probably null
R6494:Dnah7b	UTSW	1	46099431	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46224742	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46340217	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46191788	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46195120	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46119268	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46358238	missense	probably damaging	1.00
R6993:Dnah7b	UTSW	1	46195139	critical splice donor site	probably null
R7040:Dnah7b	UTSW	1	46236809	missense	probably benign	0.01
R7117:Dnah7b	UTSW	1	46352813	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46139710	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46126804	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46242142	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46139966	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46083754	missense	probably benign
R7244:Dnah7b	UTSW	1	46277143	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46142085	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46195372	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46303634	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46175419	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46290734	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46325765	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46356554	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46124346	missense	probably benign	0.06
R7547:Dnah7b	UTSW	1	46214413	missense	possibly damaging	0.82
R7620:Dnah7b	UTSW	1	46268634	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46109302	missense	probably benign
R7676:Dnah7b	UTSW	1	46234164	nonsense	probably null
R7731:Dnah7b	UTSW	1	46139745	missense	probably benign	0.00
R7760:Dnah7b	UTSW	1	46201253	missense	probably damaging	1.00
R7768:Dnah7b	UTSW	1	46137474	missense	probably benign
R7807:Dnah7b	UTSW	1	46214367	missense	probably benign
R7895:Dnah7b	UTSW	1	46249950	missense	probably damaging	1.00
R7911:Dnah7b	UTSW	1	46139678	missense	probably damaging	1.00
R7924:Dnah7b	UTSW	1	46219430	missense	probably benign	0.04
R7944:Dnah7b	UTSW	1	46227003	missense	probably benign
R7946:Dnah7b	UTSW	1	46233579	missense	probably damaging	1.00
R7983:Dnah7b	UTSW	1	46243424	missense	probably damaging	1.00
R8012:Dnah7b	UTSW	1	46243365	missense	probably damaging	1.00
R8069:Dnah7b	UTSW	1	46224706	nonsense	probably null
R8094:Dnah7b	UTSW	1	46126804	missense	probably benign	0.01
R8137:Dnah7b	UTSW	1	46233753	missense	probably damaging	1.00
R8167:Dnah7b	UTSW	1	46253511	missense	possibly damaging	0.95
R8268:Dnah7b	UTSW	1	46356576	missense	probably benign	0.43
R8309:Dnah7b	UTSW	1	46139872	missense	probably damaging	1.00
R8313:Dnah7b	UTSW	1	46175296	missense	possibly damaging	0.81
R8410:Dnah7b	UTSW	1	46356659	critical splice donor site	probably null
R8438:Dnah7b	UTSW	1	46188679	missense	probably damaging	1.00
R8446:Dnah7b	UTSW	1	46290715	missense	probably damaging	1.00
R8471:Dnah7b	UTSW	1	46099490	missense	possibly damaging	0.92
R8551:Dnah7b	UTSW	1	46116200	missense	possibly damaging	0.94
R8711:Dnah7b	UTSW	1	46175438	missense	probably damaging	1.00
R8745:Dnah7b	UTSW	1	46182464	missense	possibly damaging	0.82
R8765:Dnah7b	UTSW	1	46352999	missense	possibly damaging	0.91
R8797:Dnah7b	UTSW	1	46123646	missense	probably damaging	1.00
R8805:Dnah7b	UTSW	1	46234145	missense	possibly damaging	0.90
R8830:Dnah7b	UTSW	1	46191793	missense	probably damaging	1.00
R8861:Dnah7b	UTSW	1	46241076	missense	possibly damaging	0.82
R8905:Dnah7b	UTSW	1	46253374	missense	probably damaging	0.99
R9009:Dnah7b	UTSW	1	46223072	missense	probably benign	0.00
R9058:Dnah7b	UTSW	1	46243415	missense	probably damaging	1.00
R9130:Dnah7b	UTSW	1	46134514	missense	probably benign	0.01
R9131:Dnah7b	UTSW	1	46227020	missense	probably damaging	1.00
R9181:Dnah7b	UTSW	1	46142034	missense	probably damaging	1.00
R9182:Dnah7b	UTSW	1	46290878	missense	probably benign	0.06
R9223:Dnah7b	UTSW	1	46322260	missense	probably benign	0.12
R9391:Dnah7b	UTSW	1	46233754	nonsense	probably null
R9392:Dnah7b	UTSW	1	46123738	nonsense	probably null
R9456:Dnah7b	UTSW	1	46126793	missense	possibly damaging	0.82
R9498:Dnah7b	UTSW	1	46214404	missense	probably benign	0.27
R9553:Dnah7b	UTSW	1	46225796	missense	probably damaging	0.99
R9598:Dnah7b	UTSW	1	46253461	missense	possibly damaging	0.67
R9653:Dnah7b	UTSW	1	46213384	missense	possibly damaging	0.55
R9781:Dnah7b	UTSW	1	46337594	splice site	probably null
RF020:Dnah7b	UTSW	1	46373261	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46373298	nonsense	probably null
X0023:Dnah7b	UTSW	1	46303577	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACACCCTGGAACTCCCACTGTTTG -3'
(R):5'- GCCACTTTAATGTAAGTGCTGCCAC -3'

Sequencing Primer
(F):5'- tgtgatgcagtgcagcc -3'
(R):5'- AAGTGCTGCCACTGAGTATC -3'

Posted On

2014-05-23