Incidental Mutation 'R1753:Map3k19'
ID 193688
Institutional Source Beutler Lab
Gene Symbol Map3k19
Ensembl Gene ENSMUSG00000051590
Gene Name mitogen-activated protein kinase kinase kinase 19
Synonyms Ysk4
MMRRC Submission 039785-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R1753 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 127742528-127782768 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127750417 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 978 (M978T)
Ref Sequence ENSEMBL: ENSMUSP00000146463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]
AlphaFold E9Q3S4
Predicted Effect probably benign
Transcript: ENSMUST00000061512
AA Change: M774T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: M774T

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187653
AA Change: M673T
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: M673T

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189398
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191333
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208183
AA Change: M978T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,864,542 (GRCm39) F409I probably benign Het
Adamts19 A C 18: 59,140,444 (GRCm39) I848L possibly damaging Het
Adamts5 T C 16: 85,696,240 (GRCm39) S306G probably damaging Het
Adamts8 T G 9: 30,865,910 (GRCm39) I486S probably benign Het
Adgrg5 T C 8: 95,668,680 (GRCm39) F499L possibly damaging Het
Akr1c21 T A 13: 4,627,134 (GRCm39) C145* probably null Het
Anp32b T G 4: 46,460,241 (GRCm39) probably null Het
Arhgap31 A G 16: 38,421,974 (GRCm39) V1364A possibly damaging Het
C2cd6 T C 1: 59,133,992 (GRCm39) R10G possibly damaging Het
Cacna2d1 A G 5: 16,507,352 (GRCm39) E367G possibly damaging Het
Ccdc81 C T 7: 89,515,769 (GRCm39) E637K probably benign Het
Cd2 A T 3: 101,194,815 (GRCm39) M91K possibly damaging Het
Cdc16 C A 8: 13,814,688 (GRCm39) Y157* probably null Het
Celsr3 G T 9: 108,709,056 (GRCm39) V1301F probably damaging Het
Cep164 C T 9: 45,704,235 (GRCm39) G961S probably damaging Het
Cep290 T C 10: 100,349,843 (GRCm39) V630A probably benign Het
Chd5 C T 4: 152,463,272 (GRCm39) S1451F probably damaging Het
Cldn23 A C 8: 36,293,140 (GRCm39) L116R possibly damaging Het
Cngb1 A T 8: 96,024,401 (GRCm39) probably benign Het
Cpb1 G T 3: 20,320,405 (GRCm39) N151K possibly damaging Het
Cpn2 A G 16: 30,078,918 (GRCm39) F261S probably damaging Het
Crlf3 A C 11: 79,948,698 (GRCm39) V249G probably damaging Het
Csmd1 A T 8: 16,207,134 (GRCm39) Y1298* probably null Het
Cstf2t C A 19: 31,061,085 (GRCm39) P207Q possibly damaging Het
Cym A C 3: 107,120,741 (GRCm39) L288R possibly damaging Het
Cyp2j12 C T 4: 96,009,669 (GRCm39) probably null Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dnah7b T C 1: 46,361,495 (GRCm39) F3465S probably damaging Het
Dnmt3a A T 12: 3,923,342 (GRCm39) M181L possibly damaging Het
Duox1 T A 2: 122,163,910 (GRCm39) M859K probably damaging Het
Eif2b4 A T 5: 31,350,284 (GRCm39) S13T probably benign Het
Ercc6 T C 14: 32,298,956 (GRCm39) V1448A probably benign Het
Esp24 A G 17: 39,350,893 (GRCm39) E31G possibly damaging Het
F2rl2 T A 13: 95,837,969 (GRCm39) M338K probably benign Het
Fbxl9 A T 8: 106,039,824 (GRCm39) V517E probably damaging Het
Fgfbp1 A C 5: 44,137,265 (GRCm39) L9R possibly damaging Het
Gal3st2b A T 1: 93,868,338 (GRCm39) N188Y probably damaging Het
Gpr179 G C 11: 97,237,404 (GRCm39) C372W probably damaging Het
Grn T G 11: 102,324,093 (GRCm39) C61G probably damaging Het
Herc1 T G 9: 66,376,292 (GRCm39) C3371G probably damaging Het
Herc1 T C 9: 66,409,366 (GRCm39) probably null Het
Hmcn1 C T 1: 150,462,219 (GRCm39) G5153D possibly damaging Het
Ifi35 A T 11: 101,347,461 (GRCm39) R31W probably damaging Het
Ifit1bl1 T A 19: 34,571,260 (GRCm39) H399L probably benign Het
Irx3 G A 8: 92,527,362 (GRCm39) P114L probably damaging Het
Kat6a T A 8: 23,425,813 (GRCm39) D1119E probably benign Het
Kmt2d G T 15: 98,741,363 (GRCm39) probably benign Het
Kng1 A T 16: 22,897,869 (GRCm39) H423L possibly damaging Het
Lrp2 T A 2: 69,326,833 (GRCm39) Q1746L possibly damaging Het
Lrrc63 A T 14: 75,323,784 (GRCm39) probably null Het
Mad2l1 T A 6: 66,516,797 (GRCm39) V163E possibly damaging Het
Mon1a A C 9: 107,778,562 (GRCm39) N262T probably damaging Het
Mpo A G 11: 87,686,707 (GRCm39) N85D probably benign Het
Mpp4 T C 1: 59,183,969 (GRCm39) D244G probably null Het
Mstn A G 1: 53,105,717 (GRCm39) Y353C probably damaging Het
Mx1 T A 16: 97,255,358 (GRCm39) N232Y probably damaging Het
Mycs T C X: 5,380,157 (GRCm39) R308G probably benign Het
Myh11 A T 16: 14,095,734 (GRCm39) D9E probably benign Het
Nfe2l3 A T 6: 51,410,392 (GRCm39) Q169L probably null Het
Nr5a1 G T 2: 38,598,431 (GRCm39) T122N possibly damaging Het
Nras A G 3: 102,966,295 (GRCm39) T20A probably damaging Het
Obp2b T A 2: 25,628,652 (GRCm39) probably null Het
Or1l4 A G 2: 37,091,439 (GRCm39) Y62C probably damaging Het
Or51g2 T C 7: 102,622,263 (GRCm39) N312S probably benign Het
Or5aq6 T C 2: 86,923,571 (GRCm39) T57A probably damaging Het
Or5w18 T A 2: 87,633,106 (GRCm39) F124L probably benign Het
Or9s14 G A 1: 92,536,122 (GRCm39) V188M probably benign Het
Pcdh17 A T 14: 84,715,094 (GRCm39) T920S probably benign Het
Pcdh9 T C 14: 94,124,661 (GRCm39) D503G probably benign Het
Pcdhb12 C T 18: 37,569,724 (GRCm39) T290I probably damaging Het
Pde6b C A 5: 108,536,557 (GRCm39) C84* probably null Het
Pex1 A T 5: 3,680,044 (GRCm39) N914I probably damaging Het
Pign A G 1: 105,517,042 (GRCm39) V528A possibly damaging Het
Pkhd1 T G 1: 20,604,129 (GRCm39) D1187A possibly damaging Het
Ppip5k1 T C 2: 121,173,112 (GRCm39) K489E probably damaging Het
Prob1 T C 18: 35,786,305 (GRCm39) T650A possibly damaging Het
Radil T C 5: 142,481,091 (GRCm39) Y572C probably damaging Het
Rapgef2 A G 3: 78,996,098 (GRCm39) I555T possibly damaging Het
Rgs5 G A 1: 169,510,386 (GRCm39) probably null Het
Rnaset2b G A 17: 7,248,506 (GRCm39) probably null Het
S1pr1 A G 3: 115,505,587 (GRCm39) S336P probably benign Het
Slc24a5 A G 2: 124,925,115 (GRCm39) E252G possibly damaging Het
Slc34a2 A T 5: 53,218,733 (GRCm39) I184F probably benign Het
Slc35a3 A G 3: 116,471,597 (GRCm39) V224A possibly damaging Het
Slc39a9 A G 12: 80,723,976 (GRCm39) H211R probably damaging Het
Slu7 A G 11: 43,330,095 (GRCm39) N174S probably benign Het
Smarcd3 A T 5: 24,800,820 (GRCm39) Y131* probably null Het
Syne1 A G 10: 5,317,621 (GRCm39) M491T probably benign Het
Tars1 G A 15: 11,394,329 (GRCm39) Q103* probably null Het
Tmem132d C A 5: 127,866,919 (GRCm39) E660D probably benign Het
Ttn T C 2: 76,575,387 (GRCm39) T16842A probably damaging Het
Ttn T C 2: 76,643,316 (GRCm39) E13201G probably damaging Het
Ttn T A 2: 76,582,605 (GRCm39) M22763L probably benign Het
Ubp1 A T 9: 113,785,037 (GRCm39) I117L possibly damaging Het
Usp24 T A 4: 106,234,756 (GRCm39) H954Q probably benign Het
Vmn1r174 G A 7: 23,453,622 (GRCm39) R96H probably benign Het
Vmn2r63 G A 7: 42,577,669 (GRCm39) Q290* probably null Het
Vnn3 T C 10: 23,741,718 (GRCm39) I341T probably benign Het
Wbp2nl A G 15: 82,189,945 (GRCm39) T46A probably damaging Het
Wdr48 G T 9: 119,753,313 (GRCm39) E625* probably null Het
Wdr6 C T 9: 108,452,363 (GRCm39) V507I probably damaging Het
Zp2 A T 7: 119,737,328 (GRCm39) W287R probably benign Het
Other mutations in Map3k19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Map3k19 APN 1 127,752,068 (GRCm39) nonsense probably null
IGL01367:Map3k19 APN 1 127,752,088 (GRCm39) missense possibly damaging 0.88
IGL01443:Map3k19 APN 1 127,766,244 (GRCm39) missense probably benign 0.38
IGL01481:Map3k19 APN 1 127,750,215 (GRCm39) missense probably damaging 0.99
IGL01530:Map3k19 APN 1 127,749,841 (GRCm39) missense probably damaging 1.00
IGL01603:Map3k19 APN 1 127,758,010 (GRCm39) missense possibly damaging 0.89
IGL02044:Map3k19 APN 1 127,751,242 (GRCm39) missense probably damaging 1.00
IGL02159:Map3k19 APN 1 127,750,907 (GRCm39) missense probably benign 0.00
IGL02296:Map3k19 APN 1 127,751,983 (GRCm39) missense probably damaging 1.00
IGL02349:Map3k19 APN 1 127,751,506 (GRCm39) missense possibly damaging 0.48
IGL02823:Map3k19 APN 1 127,750,001 (GRCm39) missense probably benign 0.01
IGL02965:Map3k19 APN 1 127,751,803 (GRCm39) missense probably damaging 0.98
IGL03137:Map3k19 APN 1 127,752,052 (GRCm39) missense probably benign 0.04
R0125:Map3k19 UTSW 1 127,750,837 (GRCm39) missense probably benign 0.07
R0265:Map3k19 UTSW 1 127,749,919 (GRCm39) missense possibly damaging 0.61
R0389:Map3k19 UTSW 1 127,750,152 (GRCm39) missense probably benign 0.08
R0443:Map3k19 UTSW 1 127,750,152 (GRCm39) missense probably benign 0.08
R0465:Map3k19 UTSW 1 127,766,264 (GRCm39) missense probably damaging 1.00
R0645:Map3k19 UTSW 1 127,749,919 (GRCm39) missense possibly damaging 0.61
R0759:Map3k19 UTSW 1 127,745,162 (GRCm39) missense possibly damaging 0.90
R0815:Map3k19 UTSW 1 127,762,375 (GRCm39) splice site probably benign
R0838:Map3k19 UTSW 1 127,751,696 (GRCm39) missense probably benign 0.13
R1173:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1174:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1175:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1457:Map3k19 UTSW 1 127,745,635 (GRCm39) missense probably damaging 1.00
R1661:Map3k19 UTSW 1 127,745,393 (GRCm39) missense possibly damaging 0.95
R1665:Map3k19 UTSW 1 127,745,393 (GRCm39) missense possibly damaging 0.95
R1944:Map3k19 UTSW 1 127,750,859 (GRCm39) missense probably benign 0.29
R2496:Map3k19 UTSW 1 127,750,823 (GRCm39) missense probably damaging 1.00
R2878:Map3k19 UTSW 1 127,751,530 (GRCm39) missense possibly damaging 0.61
R2895:Map3k19 UTSW 1 127,749,835 (GRCm39) missense possibly damaging 0.60
R3025:Map3k19 UTSW 1 127,766,290 (GRCm39) critical splice acceptor site probably null
R4577:Map3k19 UTSW 1 127,750,550 (GRCm39) nonsense probably null
R4612:Map3k19 UTSW 1 127,743,037 (GRCm39) missense probably benign 0.07
R4888:Map3k19 UTSW 1 127,745,470 (GRCm39) missense probably damaging 1.00
R4927:Map3k19 UTSW 1 127,749,932 (GRCm39) missense probably benign 0.08
R5028:Map3k19 UTSW 1 127,750,969 (GRCm39) missense probably benign 0.00
R5050:Map3k19 UTSW 1 127,751,299 (GRCm39) missense probably benign 0.21
R5131:Map3k19 UTSW 1 127,751,427 (GRCm39) missense possibly damaging 0.78
R5556:Map3k19 UTSW 1 127,762,284 (GRCm39) nonsense probably null
R5606:Map3k19 UTSW 1 127,750,694 (GRCm39) missense probably benign
R5617:Map3k19 UTSW 1 127,750,703 (GRCm39) missense probably damaging 1.00
R5755:Map3k19 UTSW 1 127,750,118 (GRCm39) missense probably benign 0.02
R5854:Map3k19 UTSW 1 127,758,092 (GRCm39) missense probably damaging 0.96
R5952:Map3k19 UTSW 1 127,750,477 (GRCm39) missense probably benign 0.01
R6132:Map3k19 UTSW 1 127,778,213 (GRCm39) missense possibly damaging 0.53
R6175:Map3k19 UTSW 1 127,750,569 (GRCm39) missense probably benign 0.05
R6261:Map3k19 UTSW 1 127,750,336 (GRCm39) missense possibly damaging 0.95
R6471:Map3k19 UTSW 1 127,744,991 (GRCm39) missense probably damaging 1.00
R6726:Map3k19 UTSW 1 127,748,185 (GRCm39) missense probably benign 0.09
R6732:Map3k19 UTSW 1 127,751,969 (GRCm39) missense probably benign 0.37
R6762:Map3k19 UTSW 1 127,775,001 (GRCm39) missense probably damaging 1.00
R7366:Map3k19 UTSW 1 127,745,192 (GRCm39) missense probably damaging 1.00
R7414:Map3k19 UTSW 1 127,766,189 (GRCm39) missense probably damaging 0.99
R7686:Map3k19 UTSW 1 127,749,985 (GRCm39) nonsense probably null
R7702:Map3k19 UTSW 1 127,756,827 (GRCm39) missense probably damaging 1.00
R7849:Map3k19 UTSW 1 127,751,383 (GRCm39) missense probably benign 0.21
R8129:Map3k19 UTSW 1 127,750,420 (GRCm39) missense possibly damaging 0.90
R8134:Map3k19 UTSW 1 127,751,492 (GRCm39) missense probably damaging 0.99
R8136:Map3k19 UTSW 1 127,751,492 (GRCm39) missense probably damaging 0.99
R8264:Map3k19 UTSW 1 127,751,528 (GRCm39) missense
R8305:Map3k19 UTSW 1 127,745,007 (GRCm39) missense
R8511:Map3k19 UTSW 1 127,775,155 (GRCm39) missense possibly damaging 0.71
R8808:Map3k19 UTSW 1 127,751,866 (GRCm39) missense probably damaging 1.00
R8913:Map3k19 UTSW 1 127,750,363 (GRCm39) missense probably benign 0.08
R9025:Map3k19 UTSW 1 127,758,175 (GRCm39) missense probably benign 0.06
R9593:Map3k19 UTSW 1 127,778,163 (GRCm39) missense probably benign 0.01
R9681:Map3k19 UTSW 1 127,750,097 (GRCm39) missense possibly damaging 0.61
Z1177:Map3k19 UTSW 1 127,749,771 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CTTCAGGCTCTTTCAGATCGCCAAG -3'
(R):5'- TCCGAAAGTGACAGGTGCAGCAAC -3'

Sequencing Primer
(F):5'- AGGCTTTGGGTAAGGCTGTC -3'
(R):5'- AGCAGGGCAAGACTTCTTC -3'
Posted On 2014-05-23