Incidental Mutation 'R1753:Hmcn1'
ID 193689
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Name hemicentin 1
Synonyms EG545370, LOC240793
MMRRC Submission 039785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1753 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 150438275-150869186 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 150462219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 5153 (G5153D)
Ref Sequence ENSEMBL: ENSMUSP00000121500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197] [ENSMUST00000177036]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000074783
AA Change: G5153D

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: G5153D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137197
AA Change: G5153D

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: G5153D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177036
SMART Domains Protein: ENSMUSP00000134985
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
EGF_CA 16 57 6.8e-8 SMART
EGF_CA 58 100 3.51e-10 SMART
EGF_CA 101 140 2.78e-13 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,864,542 (GRCm39) F409I probably benign Het
Adamts19 A C 18: 59,140,444 (GRCm39) I848L possibly damaging Het
Adamts5 T C 16: 85,696,240 (GRCm39) S306G probably damaging Het
Adamts8 T G 9: 30,865,910 (GRCm39) I486S probably benign Het
Adgrg5 T C 8: 95,668,680 (GRCm39) F499L possibly damaging Het
Akr1c21 T A 13: 4,627,134 (GRCm39) C145* probably null Het
Anp32b T G 4: 46,460,241 (GRCm39) probably null Het
Arhgap31 A G 16: 38,421,974 (GRCm39) V1364A possibly damaging Het
C2cd6 T C 1: 59,133,992 (GRCm39) R10G possibly damaging Het
Cacna2d1 A G 5: 16,507,352 (GRCm39) E367G possibly damaging Het
Ccdc81 C T 7: 89,515,769 (GRCm39) E637K probably benign Het
Cd2 A T 3: 101,194,815 (GRCm39) M91K possibly damaging Het
Cdc16 C A 8: 13,814,688 (GRCm39) Y157* probably null Het
Celsr3 G T 9: 108,709,056 (GRCm39) V1301F probably damaging Het
Cep164 C T 9: 45,704,235 (GRCm39) G961S probably damaging Het
Cep290 T C 10: 100,349,843 (GRCm39) V630A probably benign Het
Chd5 C T 4: 152,463,272 (GRCm39) S1451F probably damaging Het
Cldn23 A C 8: 36,293,140 (GRCm39) L116R possibly damaging Het
Cngb1 A T 8: 96,024,401 (GRCm39) probably benign Het
Cpb1 G T 3: 20,320,405 (GRCm39) N151K possibly damaging Het
Cpn2 A G 16: 30,078,918 (GRCm39) F261S probably damaging Het
Crlf3 A C 11: 79,948,698 (GRCm39) V249G probably damaging Het
Csmd1 A T 8: 16,207,134 (GRCm39) Y1298* probably null Het
Cstf2t C A 19: 31,061,085 (GRCm39) P207Q possibly damaging Het
Cym A C 3: 107,120,741 (GRCm39) L288R possibly damaging Het
Cyp2j12 C T 4: 96,009,669 (GRCm39) probably null Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dnah7b T C 1: 46,361,495 (GRCm39) F3465S probably damaging Het
Dnmt3a A T 12: 3,923,342 (GRCm39) M181L possibly damaging Het
Duox1 T A 2: 122,163,910 (GRCm39) M859K probably damaging Het
Eif2b4 A T 5: 31,350,284 (GRCm39) S13T probably benign Het
Ercc6 T C 14: 32,298,956 (GRCm39) V1448A probably benign Het
Esp24 A G 17: 39,350,893 (GRCm39) E31G possibly damaging Het
F2rl2 T A 13: 95,837,969 (GRCm39) M338K probably benign Het
Fbxl9 A T 8: 106,039,824 (GRCm39) V517E probably damaging Het
Fgfbp1 A C 5: 44,137,265 (GRCm39) L9R possibly damaging Het
Gal3st2b A T 1: 93,868,338 (GRCm39) N188Y probably damaging Het
Gpr179 G C 11: 97,237,404 (GRCm39) C372W probably damaging Het
Grn T G 11: 102,324,093 (GRCm39) C61G probably damaging Het
Herc1 T G 9: 66,376,292 (GRCm39) C3371G probably damaging Het
Herc1 T C 9: 66,409,366 (GRCm39) probably null Het
Ifi35 A T 11: 101,347,461 (GRCm39) R31W probably damaging Het
Ifit1bl1 T A 19: 34,571,260 (GRCm39) H399L probably benign Het
Irx3 G A 8: 92,527,362 (GRCm39) P114L probably damaging Het
Kat6a T A 8: 23,425,813 (GRCm39) D1119E probably benign Het
Kmt2d G T 15: 98,741,363 (GRCm39) probably benign Het
Kng1 A T 16: 22,897,869 (GRCm39) H423L possibly damaging Het
Lrp2 T A 2: 69,326,833 (GRCm39) Q1746L possibly damaging Het
Lrrc63 A T 14: 75,323,784 (GRCm39) probably null Het
Mad2l1 T A 6: 66,516,797 (GRCm39) V163E possibly damaging Het
Map3k19 A G 1: 127,750,417 (GRCm39) M978T probably benign Het
Mon1a A C 9: 107,778,562 (GRCm39) N262T probably damaging Het
Mpo A G 11: 87,686,707 (GRCm39) N85D probably benign Het
Mpp4 T C 1: 59,183,969 (GRCm39) D244G probably null Het
Mstn A G 1: 53,105,717 (GRCm39) Y353C probably damaging Het
Mx1 T A 16: 97,255,358 (GRCm39) N232Y probably damaging Het
Mycs T C X: 5,380,157 (GRCm39) R308G probably benign Het
Myh11 A T 16: 14,095,734 (GRCm39) D9E probably benign Het
Nfe2l3 A T 6: 51,410,392 (GRCm39) Q169L probably null Het
Nr5a1 G T 2: 38,598,431 (GRCm39) T122N possibly damaging Het
Nras A G 3: 102,966,295 (GRCm39) T20A probably damaging Het
Obp2b T A 2: 25,628,652 (GRCm39) probably null Het
Or1l4 A G 2: 37,091,439 (GRCm39) Y62C probably damaging Het
Or51g2 T C 7: 102,622,263 (GRCm39) N312S probably benign Het
Or5aq6 T C 2: 86,923,571 (GRCm39) T57A probably damaging Het
Or5w18 T A 2: 87,633,106 (GRCm39) F124L probably benign Het
Or9s14 G A 1: 92,536,122 (GRCm39) V188M probably benign Het
Pcdh17 A T 14: 84,715,094 (GRCm39) T920S probably benign Het
Pcdh9 T C 14: 94,124,661 (GRCm39) D503G probably benign Het
Pcdhb12 C T 18: 37,569,724 (GRCm39) T290I probably damaging Het
Pde6b C A 5: 108,536,557 (GRCm39) C84* probably null Het
Pex1 A T 5: 3,680,044 (GRCm39) N914I probably damaging Het
Pign A G 1: 105,517,042 (GRCm39) V528A possibly damaging Het
Pkhd1 T G 1: 20,604,129 (GRCm39) D1187A possibly damaging Het
Ppip5k1 T C 2: 121,173,112 (GRCm39) K489E probably damaging Het
Prob1 T C 18: 35,786,305 (GRCm39) T650A possibly damaging Het
Radil T C 5: 142,481,091 (GRCm39) Y572C probably damaging Het
Rapgef2 A G 3: 78,996,098 (GRCm39) I555T possibly damaging Het
Rgs5 G A 1: 169,510,386 (GRCm39) probably null Het
Rnaset2b G A 17: 7,248,506 (GRCm39) probably null Het
S1pr1 A G 3: 115,505,587 (GRCm39) S336P probably benign Het
Slc24a5 A G 2: 124,925,115 (GRCm39) E252G possibly damaging Het
Slc34a2 A T 5: 53,218,733 (GRCm39) I184F probably benign Het
Slc35a3 A G 3: 116,471,597 (GRCm39) V224A possibly damaging Het
Slc39a9 A G 12: 80,723,976 (GRCm39) H211R probably damaging Het
Slu7 A G 11: 43,330,095 (GRCm39) N174S probably benign Het
Smarcd3 A T 5: 24,800,820 (GRCm39) Y131* probably null Het
Syne1 A G 10: 5,317,621 (GRCm39) M491T probably benign Het
Tars1 G A 15: 11,394,329 (GRCm39) Q103* probably null Het
Tmem132d C A 5: 127,866,919 (GRCm39) E660D probably benign Het
Ttn T C 2: 76,575,387 (GRCm39) T16842A probably damaging Het
Ttn T C 2: 76,643,316 (GRCm39) E13201G probably damaging Het
Ttn T A 2: 76,582,605 (GRCm39) M22763L probably benign Het
Ubp1 A T 9: 113,785,037 (GRCm39) I117L possibly damaging Het
Usp24 T A 4: 106,234,756 (GRCm39) H954Q probably benign Het
Vmn1r174 G A 7: 23,453,622 (GRCm39) R96H probably benign Het
Vmn2r63 G A 7: 42,577,669 (GRCm39) Q290* probably null Het
Vnn3 T C 10: 23,741,718 (GRCm39) I341T probably benign Het
Wbp2nl A G 15: 82,189,945 (GRCm39) T46A probably damaging Het
Wdr48 G T 9: 119,753,313 (GRCm39) E625* probably null Het
Wdr6 C T 9: 108,452,363 (GRCm39) V507I probably damaging Het
Zp2 A T 7: 119,737,328 (GRCm39) W287R probably benign Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150,553,029 (GRCm39) missense probably benign
IGL00571:Hmcn1 APN 1 150,514,750 (GRCm39) missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150,682,117 (GRCm39) critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150,540,687 (GRCm39) missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150,532,485 (GRCm39) missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150,506,091 (GRCm39) missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150,486,464 (GRCm39) missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150,480,757 (GRCm39) missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150,458,052 (GRCm39) missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150,514,620 (GRCm39) missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150,502,784 (GRCm39) missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150,508,303 (GRCm39) splice site probably benign
IGL01304:Hmcn1 APN 1 150,498,675 (GRCm39) missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150,620,752 (GRCm39) missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150,594,991 (GRCm39) missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150,468,848 (GRCm39) missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150,734,990 (GRCm39) missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150,480,823 (GRCm39) missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150,485,382 (GRCm39) missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150,474,148 (GRCm39) missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150,503,164 (GRCm39) missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150,547,783 (GRCm39) missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150,455,984 (GRCm39) missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150,613,050 (GRCm39) missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150,459,031 (GRCm39) missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150,620,711 (GRCm39) missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150,547,789 (GRCm39) missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150,491,051 (GRCm39) missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150,566,352 (GRCm39) missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150,618,011 (GRCm39) splice site probably benign
IGL01906:Hmcn1 APN 1 150,543,638 (GRCm39) missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150,608,643 (GRCm39) missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150,479,622 (GRCm39) missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150,491,049 (GRCm39) missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150,579,932 (GRCm39) missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150,506,479 (GRCm39) missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150,598,358 (GRCm39) missense probably benign
IGL02155:Hmcn1 APN 1 150,439,349 (GRCm39) missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150,682,152 (GRCm39) missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150,540,666 (GRCm39) missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150,678,648 (GRCm39) missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150,598,175 (GRCm39) missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150,868,774 (GRCm39) missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150,685,477 (GRCm39) missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150,573,244 (GRCm39) missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150,620,746 (GRCm39) missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150,494,760 (GRCm39) missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150,480,654 (GRCm39) missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150,532,445 (GRCm39) nonsense probably null
IGL02735:Hmcn1 APN 1 150,522,583 (GRCm39) missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150,439,579 (GRCm39) missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150,551,725 (GRCm39) critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150,453,029 (GRCm39) missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150,532,958 (GRCm39) missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150,573,273 (GRCm39) missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150,547,668 (GRCm39) missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150,684,290 (GRCm39) missense probably benign
IGL03195:Hmcn1 APN 1 150,678,660 (GRCm39) missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150,619,418 (GRCm39) missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150,646,103 (GRCm39) splice site probably benign
IGL03268:Hmcn1 APN 1 150,648,261 (GRCm39) missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150,474,175 (GRCm39) missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150,505,982 (GRCm39) missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150,608,661 (GRCm39) missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150,577,720 (GRCm39) missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150,539,623 (GRCm39) missense probably damaging 1.00
Backbone UTSW 1 150,498,745 (GRCm39) missense probably benign 0.09
Cambrian UTSW 1 150,608,597 (GRCm39) missense probably damaging 1.00
chordate UTSW 1 150,462,766 (GRCm39) missense probably benign 0.00
Justamere UTSW 1 150,464,008 (GRCm39) missense probably damaging 1.00
Lancelet UTSW 1 150,551,291 (GRCm39) missense probably benign 0.00
notochord UTSW 1 150,646,044 (GRCm39) missense probably benign 0.00
wippoorwill UTSW 1 150,608,697 (GRCm39) missense probably damaging 1.00
BB004:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
BB014:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
IGL02991:Hmcn1 UTSW 1 150,614,409 (GRCm39) missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150,596,440 (GRCm39) missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150,684,488 (GRCm39) missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150,545,238 (GRCm39) missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150,684,427 (GRCm39) missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150,528,302 (GRCm39) missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150,553,157 (GRCm39) missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150,462,766 (GRCm39) missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150,684,398 (GRCm39) missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150,553,075 (GRCm39) missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150,539,630 (GRCm39) missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150,479,562 (GRCm39) missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150,674,565 (GRCm39) missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150,591,573 (GRCm39) missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150,608,543 (GRCm39) splice site probably benign
R0503:Hmcn1 UTSW 1 150,735,003 (GRCm39) missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150,752,170 (GRCm39) splice site probably benign
R0506:Hmcn1 UTSW 1 150,618,092 (GRCm39) missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150,594,868 (GRCm39) missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150,525,768 (GRCm39) nonsense probably null
R0599:Hmcn1 UTSW 1 150,485,552 (GRCm39) missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150,533,127 (GRCm39) critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150,469,767 (GRCm39) missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150,674,470 (GRCm39) splice site probably null
R0699:Hmcn1 UTSW 1 150,695,161 (GRCm39) missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150,684,538 (GRCm39) missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150,629,416 (GRCm39) missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150,525,824 (GRCm39) missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R0975:Hmcn1 UTSW 1 150,453,128 (GRCm39) missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150,494,679 (GRCm39) missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150,494,679 (GRCm39) missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R1145:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R1233:Hmcn1 UTSW 1 150,624,777 (GRCm39) missense probably benign
R1234:Hmcn1 UTSW 1 150,629,405 (GRCm39) nonsense probably null
R1291:Hmcn1 UTSW 1 150,623,942 (GRCm39) missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150,462,219 (GRCm39) missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150,556,466 (GRCm39) missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150,522,545 (GRCm39) missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150,528,257 (GRCm39) splice site probably benign
R1458:Hmcn1 UTSW 1 150,485,451 (GRCm39) missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150,648,303 (GRCm39) missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150,545,172 (GRCm39) missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150,649,554 (GRCm39) missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150,610,283 (GRCm39) missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150,532,992 (GRCm39) missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150,620,778 (GRCm39) missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150,545,309 (GRCm39) missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150,506,084 (GRCm39) missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150,441,120 (GRCm39) nonsense probably null
R1710:Hmcn1 UTSW 1 150,551,735 (GRCm39) missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150,734,937 (GRCm39) missense probably damaging 1.00
R1756:Hmcn1 UTSW 1 150,474,781 (GRCm39) missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150,439,319 (GRCm39) missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150,624,834 (GRCm39) missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150,502,903 (GRCm39) missense probably damaging 0.98
R1794:Hmcn1 UTSW 1 150,474,036 (GRCm39) missense probably benign 0.00
R1856:Hmcn1 UTSW 1 150,597,415 (GRCm39) missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150,532,944 (GRCm39) missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150,479,563 (GRCm39) missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150,596,446 (GRCm39) missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150,453,046 (GRCm39) missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150,695,251 (GRCm39) missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150,695,251 (GRCm39) missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150,533,202 (GRCm39) missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150,868,606 (GRCm39) missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150,480,633 (GRCm39) missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150,525,427 (GRCm39) missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150,553,127 (GRCm39) missense possibly damaging 0.72
R1960:Hmcn1 UTSW 1 150,551,742 (GRCm39) missense probably benign 0.00
R2001:Hmcn1 UTSW 1 150,614,364 (GRCm39) missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150,553,085 (GRCm39) missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150,453,074 (GRCm39) missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150,509,410 (GRCm39) missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150,591,566 (GRCm39) missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150,474,761 (GRCm39) missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150,500,349 (GRCm39) splice site probably benign
R2303:Hmcn1 UTSW 1 150,579,977 (GRCm39) missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150,528,429 (GRCm39) splice site probably benign
R2338:Hmcn1 UTSW 1 150,498,685 (GRCm39) missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150,441,135 (GRCm39) missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150,736,092 (GRCm39) missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150,474,783 (GRCm39) missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150,490,972 (GRCm39) missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150,562,618 (GRCm39) nonsense probably null
R2519:Hmcn1 UTSW 1 150,649,571 (GRCm39) nonsense probably null
R2520:Hmcn1 UTSW 1 150,619,398 (GRCm39) missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150,528,326 (GRCm39) missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150,506,403 (GRCm39) critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150,439,350 (GRCm39) nonsense probably null
R2849:Hmcn1 UTSW 1 150,439,350 (GRCm39) nonsense probably null
R2869:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150,678,624 (GRCm39) missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150,624,786 (GRCm39) missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150,480,853 (GRCm39) missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150,480,853 (GRCm39) missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150,565,269 (GRCm39) missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150,620,776 (GRCm39) missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150,678,575 (GRCm39) missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150,498,745 (GRCm39) missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150,462,169 (GRCm39) missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150,525,328 (GRCm39) critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150,462,716 (GRCm39) missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150,566,361 (GRCm39) missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150,449,320 (GRCm39) missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150,598,204 (GRCm39) missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150,598,120 (GRCm39) missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150,648,253 (GRCm39) missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150,578,967 (GRCm39) missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150,534,259 (GRCm39) missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150,471,750 (GRCm39) splice site probably null
R4441:Hmcn1 UTSW 1 150,533,210 (GRCm39) missense probably null
R4493:Hmcn1 UTSW 1 150,577,650 (GRCm39) missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150,509,417 (GRCm39) missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150,439,531 (GRCm39) missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150,610,238 (GRCm39) missense probably benign
R4601:Hmcn1 UTSW 1 150,614,396 (GRCm39) missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150,471,645 (GRCm39) missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150,551,262 (GRCm39) critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150,500,301 (GRCm39) missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150,494,816 (GRCm39) missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150,648,322 (GRCm39) splice site probably null
R4724:Hmcn1 UTSW 1 150,570,584 (GRCm39) splice site probably null
R4737:Hmcn1 UTSW 1 150,565,346 (GRCm39) missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150,453,363 (GRCm39) missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150,629,362 (GRCm39) missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150,629,362 (GRCm39) missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150,468,836 (GRCm39) missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150,553,130 (GRCm39) missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150,598,286 (GRCm39) missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150,752,111 (GRCm39) intron probably benign
R4968:Hmcn1 UTSW 1 150,533,221 (GRCm39) missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150,695,200 (GRCm39) missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150,556,439 (GRCm39) missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150,464,008 (GRCm39) missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150,613,007 (GRCm39) missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150,486,420 (GRCm39) missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150,532,492 (GRCm39) missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150,522,452 (GRCm39) missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150,471,612 (GRCm39) missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150,555,265 (GRCm39) missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150,458,047 (GRCm39) missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150,631,123 (GRCm39) missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150,498,995 (GRCm39) missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150,577,723 (GRCm39) missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150,551,291 (GRCm39) missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150,485,576 (GRCm39) splice site probably null
R5531:Hmcn1 UTSW 1 150,619,539 (GRCm39) missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150,631,042 (GRCm39) missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150,613,257 (GRCm39) missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150,453,290 (GRCm39) missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150,532,318 (GRCm39) missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150,534,313 (GRCm39) missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150,485,529 (GRCm39) missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150,566,351 (GRCm39) nonsense probably null
R5718:Hmcn1 UTSW 1 150,485,417 (GRCm39) missense probably damaging 1.00
R5723:Hmcn1 UTSW 1 150,570,600 (GRCm39) missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150,634,225 (GRCm39) splice site probably null
R5739:Hmcn1 UTSW 1 150,684,448 (GRCm39) missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150,449,305 (GRCm39) missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150,570,629 (GRCm39) missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150,550,098 (GRCm39) nonsense probably null
R5809:Hmcn1 UTSW 1 150,525,358 (GRCm39) missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150,613,275 (GRCm39) missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150,868,774 (GRCm39) missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150,506,078 (GRCm39) missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150,474,648 (GRCm39) missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150,453,047 (GRCm39) nonsense probably null
R5940:Hmcn1 UTSW 1 150,532,973 (GRCm39) missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150,439,568 (GRCm39) missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150,579,924 (GRCm39) missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150,678,646 (GRCm39) missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150,508,188 (GRCm39) missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150,539,660 (GRCm39) missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150,646,081 (GRCm39) missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150,631,045 (GRCm39) missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150,631,044 (GRCm39) missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150,506,978 (GRCm39) missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150,494,687 (GRCm39) missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150,608,597 (GRCm39) missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150,598,175 (GRCm39) missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150,441,176 (GRCm39) missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150,522,535 (GRCm39) missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150,491,189 (GRCm39) splice site probably null
R6187:Hmcn1 UTSW 1 150,506,479 (GRCm39) missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150,614,432 (GRCm39) missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150,573,170 (GRCm39) critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150,573,227 (GRCm39) missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150,620,711 (GRCm39) missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150,578,967 (GRCm39) missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150,868,670 (GRCm39) missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150,540,535 (GRCm39) missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150,553,053 (GRCm39) nonsense probably null
R6490:Hmcn1 UTSW 1 150,459,029 (GRCm39) missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150,573,317 (GRCm39) missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150,491,189 (GRCm39) splice site probably null
R6612:Hmcn1 UTSW 1 150,470,869 (GRCm39) critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150,599,008 (GRCm39) critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150,619,547 (GRCm39) missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150,634,057 (GRCm39) missense probably benign
R6687:Hmcn1 UTSW 1 150,620,784 (GRCm39) missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150,579,926 (GRCm39) missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150,610,269 (GRCm39) missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150,646,044 (GRCm39) missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150,868,802 (GRCm39) start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150,475,404 (GRCm39) critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150,649,641 (GRCm39) missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150,479,853 (GRCm39) missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150,736,118 (GRCm39) missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150,479,997 (GRCm39) missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150,576,292 (GRCm39) missense probably damaging 0.98
R7129:Hmcn1 UTSW 1 150,452,961 (GRCm39) splice site probably null
R7144:Hmcn1 UTSW 1 150,539,624 (GRCm39) missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150,562,605 (GRCm39) missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150,624,744 (GRCm39) missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150,629,450 (GRCm39) missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150,525,331 (GRCm39) missense probably null 1.00
R7231:Hmcn1 UTSW 1 150,514,627 (GRCm39) missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150,598,394 (GRCm39) missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150,591,574 (GRCm39) missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150,458,088 (GRCm39) missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150,559,466 (GRCm39) missense possibly damaging 0.52
R7292:Hmcn1 UTSW 1 150,608,880 (GRCm39) splice site probably null
R7316:Hmcn1 UTSW 1 150,608,697 (GRCm39) missense probably damaging 1.00
R7327:Hmcn1 UTSW 1 150,479,565 (GRCm39) missense probably benign 0.01
R7328:Hmcn1 UTSW 1 150,514,617 (GRCm39) missense possibly damaging 0.95
R7346:Hmcn1 UTSW 1 150,559,496 (GRCm39) missense probably damaging 1.00
R7351:Hmcn1 UTSW 1 150,543,640 (GRCm39) missense probably damaging 0.98
R7354:Hmcn1 UTSW 1 150,682,196 (GRCm39) nonsense probably null
R7360:Hmcn1 UTSW 1 150,494,597 (GRCm39) missense probably damaging 1.00
R7396:Hmcn1 UTSW 1 150,439,382 (GRCm39) missense possibly damaging 0.83
R7398:Hmcn1 UTSW 1 150,522,421 (GRCm39) missense probably benign 0.00
R7400:Hmcn1 UTSW 1 150,550,181 (GRCm39) missense probably damaging 1.00
R7404:Hmcn1 UTSW 1 150,596,510 (GRCm39) missense probably benign 0.00
R7424:Hmcn1 UTSW 1 150,506,017 (GRCm39) nonsense probably null
R7454:Hmcn1 UTSW 1 150,439,355 (GRCm39) missense probably damaging 1.00
R7476:Hmcn1 UTSW 1 150,456,018 (GRCm39) missense probably damaging 0.99
R7480:Hmcn1 UTSW 1 150,552,985 (GRCm39) critical splice donor site probably null
R7516:Hmcn1 UTSW 1 150,498,718 (GRCm39) missense probably benign 0.35
R7526:Hmcn1 UTSW 1 150,532,324 (GRCm39) missense probably damaging 1.00
R7531:Hmcn1 UTSW 1 150,562,531 (GRCm39) missense probably benign 0.06
R7555:Hmcn1 UTSW 1 150,480,625 (GRCm39) missense probably benign 0.40
R7564:Hmcn1 UTSW 1 150,531,586 (GRCm39) missense probably benign
R7588:Hmcn1 UTSW 1 150,532,885 (GRCm39) missense possibly damaging 0.90
R7719:Hmcn1 UTSW 1 150,441,080 (GRCm39) missense possibly damaging 0.95
R7720:Hmcn1 UTSW 1 150,522,460 (GRCm39) missense probably benign 0.00
R7722:Hmcn1 UTSW 1 150,543,631 (GRCm39) missense probably damaging 0.98
R7761:Hmcn1 UTSW 1 150,598,196 (GRCm39) missense possibly damaging 0.70
R7787:Hmcn1 UTSW 1 150,632,343 (GRCm39) missense probably damaging 1.00
R7803:Hmcn1 UTSW 1 150,646,030 (GRCm39) missense probably benign 0.32
R7862:Hmcn1 UTSW 1 150,682,172 (GRCm39) missense probably damaging 0.96
R7876:Hmcn1 UTSW 1 150,620,722 (GRCm39) missense probably benign 0.03
R7886:Hmcn1 UTSW 1 150,533,221 (GRCm39) missense possibly damaging 0.94
R7891:Hmcn1 UTSW 1 150,468,940 (GRCm39) missense probably damaging 1.00
R7892:Hmcn1 UTSW 1 150,540,643 (GRCm39) missense probably benign 0.00
R7927:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
R7941:Hmcn1 UTSW 1 150,525,835 (GRCm39) missense possibly damaging 0.95
R7960:Hmcn1 UTSW 1 150,531,606 (GRCm39) missense probably damaging 1.00
R8001:Hmcn1 UTSW 1 150,540,629 (GRCm39) nonsense probably null
R8015:Hmcn1 UTSW 1 150,474,062 (GRCm39) missense possibly damaging 0.83
R8070:Hmcn1 UTSW 1 150,525,743 (GRCm39) nonsense probably null
R8072:Hmcn1 UTSW 1 150,532,256 (GRCm39) missense possibly damaging 0.62
R8113:Hmcn1 UTSW 1 150,624,841 (GRCm39) missense possibly damaging 0.50
R8143:Hmcn1 UTSW 1 150,734,957 (GRCm39) missense probably benign 0.03
R8145:Hmcn1 UTSW 1 150,629,411 (GRCm39) missense probably benign 0.33
R8155:Hmcn1 UTSW 1 150,480,705 (GRCm39) missense probably damaging 1.00
R8165:Hmcn1 UTSW 1 150,522,409 (GRCm39) missense probably benign 0.09
R8179:Hmcn1 UTSW 1 150,598,265 (GRCm39) missense probably benign 0.19
R8193:Hmcn1 UTSW 1 150,453,228 (GRCm39) nonsense probably null
R8234:Hmcn1 UTSW 1 150,469,761 (GRCm39) missense possibly damaging 0.83
R8249:Hmcn1 UTSW 1 150,695,117 (GRCm39) missense probably benign 0.24
R8267:Hmcn1 UTSW 1 150,735,005 (GRCm39) missense probably damaging 1.00
R8312:Hmcn1 UTSW 1 150,614,515 (GRCm39) missense probably damaging 0.99
R8338:Hmcn1 UTSW 1 150,614,485 (GRCm39) missense probably benign 0.35
R8354:Hmcn1 UTSW 1 150,634,142 (GRCm39) missense possibly damaging 0.79
R8440:Hmcn1 UTSW 1 150,570,671 (GRCm39) missense probably damaging 1.00
R8473:Hmcn1 UTSW 1 150,479,551 (GRCm39) missense possibly damaging 0.64
R8497:Hmcn1 UTSW 1 150,455,990 (GRCm39) missense probably benign 0.01
R8509:Hmcn1 UTSW 1 150,449,302 (GRCm39) nonsense probably null
R8559:Hmcn1 UTSW 1 150,551,789 (GRCm39) missense probably benign 0.25
R8701:Hmcn1 UTSW 1 150,631,008 (GRCm39) missense probably benign 0.00
R8755:Hmcn1 UTSW 1 150,509,371 (GRCm39) missense probably benign 0.19
R8765:Hmcn1 UTSW 1 150,556,413 (GRCm39) missense probably damaging 0.98
R8782:Hmcn1 UTSW 1 150,540,636 (GRCm39) missense probably benign 0.08
R8794:Hmcn1 UTSW 1 150,591,469 (GRCm39) missense probably benign 0.00
R8803:Hmcn1 UTSW 1 150,610,248 (GRCm39) missense probably damaging 1.00
R8808:Hmcn1 UTSW 1 150,531,570 (GRCm39) missense possibly damaging 0.64
R8853:Hmcn1 UTSW 1 150,547,726 (GRCm39) missense probably damaging 1.00
R8877:Hmcn1 UTSW 1 150,514,659 (GRCm39) missense probably benign 0.00
R8881:Hmcn1 UTSW 1 150,525,723 (GRCm39) missense probably damaging 1.00
R8916:Hmcn1 UTSW 1 150,649,530 (GRCm39) missense probably damaging 1.00
R9008:Hmcn1 UTSW 1 150,630,795 (GRCm39) intron probably benign
R9030:Hmcn1 UTSW 1 150,692,870 (GRCm39) missense probably benign 0.00
R9072:Hmcn1 UTSW 1 150,565,320 (GRCm39) missense probably benign 0.04
R9090:Hmcn1 UTSW 1 150,632,309 (GRCm39) missense probably damaging 1.00
R9096:Hmcn1 UTSW 1 150,532,869 (GRCm39) missense probably benign 0.04
R9102:Hmcn1 UTSW 1 150,573,331 (GRCm39) missense probably benign 0.01
R9146:Hmcn1 UTSW 1 150,474,141 (GRCm39) missense probably benign 0.02
R9157:Hmcn1 UTSW 1 150,522,343 (GRCm39) missense probably benign 0.06
R9169:Hmcn1 UTSW 1 150,506,092 (GRCm39) missense probably damaging 0.99
R9182:Hmcn1 UTSW 1 150,488,405 (GRCm39) missense probably damaging 1.00
R9182:Hmcn1 UTSW 1 150,500,337 (GRCm39) nonsense probably null
R9204:Hmcn1 UTSW 1 150,610,262 (GRCm39) missense probably benign 0.40
R9219:Hmcn1 UTSW 1 150,594,844 (GRCm39) critical splice donor site probably null
R9267:Hmcn1 UTSW 1 150,473,740 (GRCm39) missense probably benign 0.26
R9271:Hmcn1 UTSW 1 150,632,309 (GRCm39) missense probably damaging 1.00
R9274:Hmcn1 UTSW 1 150,506,046 (GRCm39) missense probably benign 0.01
R9313:Hmcn1 UTSW 1 150,522,343 (GRCm39) missense probably benign 0.06
R9414:Hmcn1 UTSW 1 150,545,187 (GRCm39) missense probably damaging 1.00
R9456:Hmcn1 UTSW 1 150,506,053 (GRCm39) nonsense probably null
R9464:Hmcn1 UTSW 1 150,599,248 (GRCm39) missense possibly damaging 0.80
R9474:Hmcn1 UTSW 1 150,506,471 (GRCm39) missense probably damaging 1.00
R9476:Hmcn1 UTSW 1 150,462,127 (GRCm39) missense probably benign 0.00
R9482:Hmcn1 UTSW 1 150,610,281 (GRCm39) missense probably benign 0.06
R9496:Hmcn1 UTSW 1 150,579,971 (GRCm39) missense probably benign 0.00
R9501:Hmcn1 UTSW 1 150,470,990 (GRCm39) missense possibly damaging 0.67
R9510:Hmcn1 UTSW 1 150,462,127 (GRCm39) missense probably benign 0.00
R9529:Hmcn1 UTSW 1 150,545,175 (GRCm39) missense probably damaging 1.00
R9566:Hmcn1 UTSW 1 150,498,660 (GRCm39) missense probably benign 0.00
R9608:Hmcn1 UTSW 1 150,475,303 (GRCm39) missense probably damaging 1.00
R9609:Hmcn1 UTSW 1 150,555,346 (GRCm39) missense probably damaging 0.96
R9616:Hmcn1 UTSW 1 150,684,473 (GRCm39) missense probably benign 0.16
R9627:Hmcn1 UTSW 1 150,506,054 (GRCm39) missense probably damaging 1.00
R9668:Hmcn1 UTSW 1 150,619,492 (GRCm39) missense probably benign 0.02
R9686:Hmcn1 UTSW 1 150,613,356 (GRCm39) missense probably damaging 0.99
R9717:Hmcn1 UTSW 1 150,485,378 (GRCm39) missense probably damaging 1.00
R9727:Hmcn1 UTSW 1 150,674,566 (GRCm39) missense probably benign 0.06
R9744:Hmcn1 UTSW 1 150,623,941 (GRCm39) missense probably damaging 1.00
R9749:Hmcn1 UTSW 1 150,632,339 (GRCm39) missense possibly damaging 0.94
R9761:Hmcn1 UTSW 1 150,868,625 (GRCm39) missense probably damaging 0.98
R9783:Hmcn1 UTSW 1 150,598,380 (GRCm39) missense probably benign 0.16
R9788:Hmcn1 UTSW 1 150,528,333 (GRCm39) missense probably benign 0.00
R9792:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9793:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9795:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9802:Hmcn1 UTSW 1 150,684,391 (GRCm39) missense probably benign 0.07
RF003:Hmcn1 UTSW 1 150,500,312 (GRCm39) missense probably damaging 1.00
RF005:Hmcn1 UTSW 1 150,510,897 (GRCm39) nonsense probably null
X0022:Hmcn1 UTSW 1 150,576,281 (GRCm39) missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150,736,127 (GRCm39) missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150,539,652 (GRCm39) missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150,524,688 (GRCm39) missense probably damaging 1.00
Z1176:Hmcn1 UTSW 1 150,539,668 (GRCm39) missense probably benign 0.12
Z1176:Hmcn1 UTSW 1 150,531,672 (GRCm39) missense possibly damaging 0.65
Z1176:Hmcn1 UTSW 1 150,462,196 (GRCm39) missense probably null 0.92
Predicted Primers PCR Primer
(F):5'- TCAGAAGGTCCAACTCGGGGTTAG -3'
(R):5'- ATCCATCACACCATGCTGCTGC -3'

Sequencing Primer
(F):5'- gggtgaatgtggtgggg -3'
(R):5'- GCGAATTCGTCATCTCTCTAGCT -3'
Posted On 2014-05-23