Mutagenetix > Incidental Mutation

Incidental Mutation 'R1753:Duox1'

193703

Institutional Source

Beutler Lab

Gene Symbol

Duox1

Ensembl Gene

ENSMUSG00000033268

Gene Name

dual oxidase 1

Synonyms

THOX1, LNOX1, 9930101G15Rik, NOXEF1

MMRRC Submission

039785-MU

Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1753 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122315672-122347972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 122333429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 859 (M859K)

Ref Sequence

ENSEMBL: ENSMUSP00000097060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099461]

AlphaFold

A2AQ92

Predicted Effect

probably damaging
Transcript: ENSMUST00000099461
AA Change: M859K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: M859K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:An_peroxidase	29	557	2.1e-134	PFAM
transmembrane domain	594	616	N/A	INTRINSIC
EFh	819	847	1.82e-4	SMART
EFh	855	883	3.45e-5	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Ferric_reduct	1087	1236	5.3e-21	PFAM
Pfam:FAD_binding_8	1272	1374	8.5e-21	PFAM
Pfam:NAD_binding_6	1380	1534	3.5e-33	PFAM

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]

Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	T	11: 109,973,716	F409I	probably benign	Het
Adamts19	A	C	18: 59,007,372	I848L	possibly damaging	Het
Adamts5	T	C	16: 85,899,352	S306G	probably damaging	Het
Adamts8	T	G	9: 30,954,614	I486S	probably benign	Het
Adgrg5	T	C	8: 94,942,052	F499L	possibly damaging	Het
Akr1c21	T	A	13: 4,577,135	C145*	probably null	Het
Anp32b	T	G	4: 46,460,241		probably null	Het
Arhgap31	A	G	16: 38,601,612	V1364A	possibly damaging	Het
C2cd6	T	C	1: 59,094,833	R10G	possibly damaging	Het
Cacna2d1	A	G	5: 16,302,354	E367G	possibly damaging	Het
Ccdc81	C	T	7: 89,866,561	E637K	probably benign	Het
Cd2	A	T	3: 101,287,499	M91K	possibly damaging	Het
Cdc16	C	A	8: 13,764,688	Y157*	probably null	Het
Celsr3	G	T	9: 108,831,857	V1301F	probably damaging	Het
Cep164	C	T	9: 45,792,937	G961S	probably damaging	Het
Cep290	T	C	10: 100,513,981	V630A	probably benign	Het
Chd5	C	T	4: 152,378,815	S1451F	probably damaging	Het
Cldn23	A	C	8: 35,825,986	L116R	possibly damaging	Het
Cngb1	A	T	8: 95,297,773		probably benign	Het
Cpb1	G	T	3: 20,266,241	N151K	possibly damaging	Het
Cpn2	A	G	16: 30,260,100	F261S	probably damaging	Het
Crlf3	A	C	11: 80,057,872	V249G	probably damaging	Het
Csmd1	A	T	8: 16,157,120	Y1298*	probably null	Het
Cstf2t	C	A	19: 31,083,685	P207Q	possibly damaging	Het
Cym	A	C	3: 107,213,425	L288R	possibly damaging	Het
Cyp2j12	C	T	4: 96,121,432		probably null	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dnah7b	T	C	1: 46,322,335	F3465S	probably damaging	Het
Dnmt3a	A	T	12: 3,873,342	M181L	possibly damaging	Het
Eif2b4	A	T	5: 31,192,940	S13T	probably benign	Het
Ercc6	T	C	14: 32,576,999	V1448A	probably benign	Het
Esp24	A	G	17: 39,040,002	E31G	possibly damaging	Het
F2rl2	T	A	13: 95,701,461	M338K	probably benign	Het
Fgfbp1	A	C	5: 43,979,923	L9R	possibly damaging	Het
Gal3st2b	A	T	1: 93,940,616	N188Y	probably damaging	Het
Gpr179	G	C	11: 97,346,578	C372W	probably damaging	Het
Grn	T	G	11: 102,433,267	C61G	probably damaging	Het
Herc1	T	G	9: 66,469,010	C3371G	probably damaging	Het
Herc1	T	C	9: 66,502,084		probably null	Het
Hmcn1	C	T	1: 150,586,468	G5153D	possibly damaging	Het
Ifi35	A	T	11: 101,456,635	R31W	probably damaging	Het
Ifit1bl1	T	A	19: 34,593,860	H399L	probably benign	Het
Irx3	G	A	8: 91,800,734	P114L	probably damaging	Het
Kat6a	T	A	8: 22,935,797	D1119E	probably benign	Het
Kmt2d	G	T	15: 98,843,482		probably benign	Het
Kng1	A	T	16: 23,079,119	H423L	possibly damaging	Het
Lrp2	T	A	2: 69,496,489	Q1746L	possibly damaging	Het
Lrrc29	A	T	8: 105,313,192	V517E	probably damaging	Het
Lrrc63	A	T	14: 75,086,344		probably null	Het
Mad2l1	T	A	6: 66,539,813	V163E	possibly damaging	Het
Map3k19	A	G	1: 127,822,680	M978T	probably benign	Het
Mon1a	A	C	9: 107,901,363	N262T	probably damaging	Het
Mpo	A	G	11: 87,795,881	N85D	probably benign	Het
Mpp4	T	C	1: 59,144,810	D244G	probably null	Het
Mstn	A	G	1: 53,066,558	Y353C	probably damaging	Het
Mx1	T	A	16: 97,454,158	N232Y	probably damaging	Het
Mycs	T	C	X: 5,468,103	R308G	probably benign	Het
Myh11	A	T	16: 14,277,870	D9E	probably benign	Het
Nfe2l3	A	T	6: 51,433,412	Q169L	probably null	Het
Nr5a1	G	T	2: 38,708,419	T122N	possibly damaging	Het
Nras	A	G	3: 103,058,979	T20A	probably damaging	Het
Obp2b	T	A	2: 25,738,640		probably null	Het
Olfr1109	T	C	2: 87,093,227	T57A	probably damaging	Het
Olfr1143	T	A	2: 87,802,762	F124L	probably benign	Het
Olfr1410	G	A	1: 92,608,400	V188M	probably benign	Het
Olfr365	A	G	2: 37,201,427	Y62C	probably damaging	Het
Olfr577	T	C	7: 102,973,056	N312S	probably benign	Het
Pcdh17	A	T	14: 84,477,654	T920S	probably benign	Het
Pcdh9	T	C	14: 93,887,225	D503G	probably benign	Het
Pcdhb12	C	T	18: 37,436,671	T290I	probably damaging	Het
Pde6b	C	A	5: 108,388,691	C84*	probably null	Het
Pex1	A	T	5: 3,630,044	N914I	probably damaging	Het
Pign	A	G	1: 105,589,317	V528A	possibly damaging	Het
Pkhd1	T	G	1: 20,533,905	D1187A	possibly damaging	Het
Ppip5k1	T	C	2: 121,342,631	K489E	probably damaging	Het
Prob1	T	C	18: 35,653,252	T650A	possibly damaging	Het
Radil	T	C	5: 142,495,336	Y572C	probably damaging	Het
Rapgef2	A	G	3: 79,088,791	I555T	possibly damaging	Het
Rgs5	G	A	1: 169,682,817		probably null	Het
Rnaset2b	G	A	17: 6,981,107		probably null	Het
S1pr1	A	G	3: 115,711,938	S336P	probably benign	Het
Slc24a5	A	G	2: 125,083,195	E252G	possibly damaging	Het
Slc34a2	A	T	5: 53,061,391	I184F	probably benign	Het
Slc35a3	A	G	3: 116,677,948	V224A	possibly damaging	Het
Slc39a9	A	G	12: 80,677,202	H211R	probably damaging	Het
Slu7	A	G	11: 43,439,268	N174S	probably benign	Het
Smarcd3	A	T	5: 24,595,822	Y131*	probably null	Het
Syne1	A	G	10: 5,367,621	M491T	probably benign	Het
Tars	G	A	15: 11,394,243	Q103*	probably null	Het
Tmem132d	C	A	5: 127,789,855	E660D	probably benign	Het
Ttn	T	C	2: 76,745,043	T16842A	probably damaging	Het
Ttn	T	A	2: 76,752,261	M22763L	probably benign	Het
Ttn	T	C	2: 76,812,972	E13201G	probably damaging	Het
Ubp1	A	T	9: 113,955,969	I117L	possibly damaging	Het
Usp24	T	A	4: 106,377,559	H954Q	probably benign	Het
Vmn1r174	G	A	7: 23,754,197	R96H	probably benign	Het
Vmn2r63	G	A	7: 42,928,245	Q290*	probably null	Het
Vnn3	T	C	10: 23,865,820	I341T	probably benign	Het
Wbp2nl	A	G	15: 82,305,744	T46A	probably damaging	Het
Wdr48	G	T	9: 119,924,247	E625*	probably null	Het
Wdr6	C	T	9: 108,575,164	V507I	probably damaging	Het
Zp2	A	T	7: 120,138,105	W287R	probably benign	Het

Other mutations in Duox1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Duox1	APN	2	122333141	missense	possibly damaging	0.55
IGL00956:Duox1	APN	2	122323306	missense	probably benign	0.42
IGL01413:Duox1	APN	2	122320710	missense	probably benign	0.03
IGL01444:Duox1	APN	2	122340090	missense	probably damaging	0.98
IGL01633:Duox1	APN	2	122333798	missense	probably benign	0.00
IGL01814:Duox1	APN	2	122346272	missense	probably damaging	0.99
IGL01868:Duox1	APN	2	122338407	missense	probably benign
IGL02096:Duox1	APN	2	122344174	missense	probably damaging	0.99
IGL02126:Duox1	APN	2	122346336	missense	probably benign	0.21
IGL02342:Duox1	APN	2	122347312	missense	probably damaging	1.00
IGL02687:Duox1	APN	2	122336415	missense	probably damaging	1.00
IGL02708:Duox1	APN	2	122326017	missense	possibly damaging	0.81
IGL02935:Duox1	APN	2	122324519	missense	possibly damaging	0.56
antiquity	UTSW	2	122340201	missense	probably damaging	1.00
Dejavous	UTSW	2	122320864	missense	probably damaging	1.00
R1706_Duox1_051	UTSW	2	122319472	missense	probably benign	0.01
R5032_duox1_732	UTSW	2	122337317	missense	probably benign
Vaguely	UTSW	2	122326135	nonsense	probably null
D4043:Duox1	UTSW	2	122344795	missense	probably benign
R0047:Duox1	UTSW	2	122346641	unclassified	probably benign
R0047:Duox1	UTSW	2	122346641	unclassified	probably benign
R0241:Duox1	UTSW	2	122333397	splice site	probably benign
R0479:Duox1	UTSW	2	122346380	missense	probably damaging	1.00
R0834:Duox1	UTSW	2	122346501	missense	probably damaging	1.00
R1105:Duox1	UTSW	2	122337702	missense	probably damaging	0.97
R1205:Duox1	UTSW	2	122327925	nonsense	probably null
R1281:Duox1	UTSW	2	122327088	missense	probably damaging	1.00
R1302:Duox1	UTSW	2	122347279	missense	probably benign	0.24
R1532:Duox1	UTSW	2	122344723	missense	probably damaging	1.00
R1706:Duox1	UTSW	2	122319472	missense	probably benign	0.01
R1719:Duox1	UTSW	2	122338644	missense	possibly damaging	0.93
R1827:Duox1	UTSW	2	122347380	nonsense	probably null
R1828:Duox1	UTSW	2	122347380	nonsense	probably null
R1940:Duox1	UTSW	2	122325984	missense	probably benign	0.06
R1944:Duox1	UTSW	2	122346520	missense	probably damaging	0.99
R2069:Duox1	UTSW	2	122333062	missense	probably benign
R2113:Duox1	UTSW	2	122337254	missense	probably benign
R2202:Duox1	UTSW	2	122344713	missense	probably benign	0.19
R2314:Duox1	UTSW	2	122333730	nonsense	probably null
R2507:Duox1	UTSW	2	122333138	missense	probably benign	0.34
R2508:Duox1	UTSW	2	122333138	missense	probably benign	0.34
R3177:Duox1	UTSW	2	122340116	missense	probably damaging	1.00
R3277:Duox1	UTSW	2	122340116	missense	probably damaging	1.00
R4124:Duox1	UTSW	2	122337421	missense	probably damaging	1.00
R4271:Duox1	UTSW	2	122324375	missense	probably damaging	0.96
R4411:Duox1	UTSW	2	122337634	missense	probably benign	0.30
R4419:Duox1	UTSW	2	122327126	missense	probably benign
R4420:Duox1	UTSW	2	122327126	missense	probably benign
R4578:Duox1	UTSW	2	122333777	missense	probably benign	0.15
R4628:Duox1	UTSW	2	122346252	missense	probably damaging	1.00
R4665:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R4666:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R4730:Duox1	UTSW	2	122333831	missense	probably damaging	1.00
R4767:Duox1	UTSW	2	122333441	missense	possibly damaging	0.79
R4857:Duox1	UTSW	2	122315731	missense	probably benign	0.05
R4904:Duox1	UTSW	2	122320864	missense	probably damaging	1.00
R5032:Duox1	UTSW	2	122337317	missense	probably benign
R5201:Duox1	UTSW	2	122327922	missense	probably benign
R5474:Duox1	UTSW	2	122346625	missense	probably benign	0.02
R5835:Duox1	UTSW	2	122327860	missense	probably benign	0.00
R5939:Duox1	UTSW	2	122346351	missense	probably damaging	1.00
R5941:Duox1	UTSW	2	122344156	missense	probably damaging	0.97
R5943:Duox1	UTSW	2	122333435	missense	probably benign	0.00
R5970:Duox1	UTSW	2	122340201	missense	probably damaging	1.00
R6023:Duox1	UTSW	2	122337684	missense	probably benign	0.19
R6050:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R6064:Duox1	UTSW	2	122320762	missense	probably benign	0.00
R6093:Duox1	UTSW	2	122347274	missense	probably benign	0.01
R6188:Duox1	UTSW	2	122319794	missense	probably benign	0.00
R6246:Duox1	UTSW	2	122327174	missense	probably damaging	1.00
R6259:Duox1	UTSW	2	122344783	missense	probably benign	0.00
R6290:Duox1	UTSW	2	122333807	missense	possibly damaging	0.92
R6300:Duox1	UTSW	2	122337700	missense	probably damaging	0.99
R6341:Duox1	UTSW	2	122337721	missense	probably damaging	0.98
R6498:Duox1	UTSW	2	122319607	missense	probably damaging	1.00
R6883:Duox1	UTSW	2	122324584	splice site	probably null
R7002:Duox1	UTSW	2	122319877	nonsense	probably null
R7410:Duox1	UTSW	2	122346393	missense	probably damaging	1.00
R7421:Duox1	UTSW	2	122323230	missense	probably damaging	1.00
R7608:Duox1	UTSW	2	122326135	nonsense	probably null
R7702:Duox1	UTSW	2	122329639	missense	possibly damaging	0.86
R7766:Duox1	UTSW	2	122337301	missense	probably benign
R7833:Duox1	UTSW	2	122324388	missense	probably damaging	1.00
R7980:Duox1	UTSW	2	122347320	missense	possibly damaging	0.71
R8275:Duox1	UTSW	2	122344768	missense	probably benign	0.02
R8717:Duox1	UTSW	2	122337671	missense	possibly damaging	0.88
R8992:Duox1	UTSW	2	122344705	missense	probably damaging	1.00
R9196:Duox1	UTSW	2	122320208	missense	probably benign	0.08
R9344:Duox1	UTSW	2	122337682	missense	probably benign	0.14
R9397:Duox1	UTSW	2	122320302	missense	possibly damaging	0.48
R9491:Duox1	UTSW	2	122326426	missense	probably benign	0.01
R9510:Duox1	UTSW	2	122329542	missense	possibly damaging	0.92
R9521:Duox1	UTSW	2	122328735	missense	possibly damaging	0.81
R9562:Duox1	UTSW	2	122320722	missense	probably damaging	1.00
R9565:Duox1	UTSW	2	122320722	missense	probably damaging	1.00
R9569:Duox1	UTSW	2	122318490	missense	probably benign
Z1176:Duox1	UTSW	2	122333038	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCAGACAGAAGTGGGCTACTGATG -3'
(R):5'- AGCATGAAGTGGAAGTCCTCCCAG -3'

Sequencing Primer
(F):5'- ATGTTGTATTGGAGATAGAGAGCC -3'
(R):5'- TTGTCCTGGAAGCCAGACTC -3'

Posted On

2014-05-23