Incidental Mutation 'R1753:Duox1'
ID193703
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Namedual oxidase 1
SynonymsTHOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission 039785-MU
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1753 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122315672-122347972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122333429 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 859 (M859K)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
Predicted Effect probably damaging
Transcript: ENSMUST00000099461
AA Change: M859K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: M859K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,973,716 F409I probably benign Het
Adamts19 A C 18: 59,007,372 I848L possibly damaging Het
Adamts5 T C 16: 85,899,352 S306G probably damaging Het
Adamts8 T G 9: 30,954,614 I486S probably benign Het
Adgrg5 T C 8: 94,942,052 F499L possibly damaging Het
Akr1c21 T A 13: 4,577,135 C145* probably null Het
Anp32b T G 4: 46,460,241 probably null Het
Arhgap31 A G 16: 38,601,612 V1364A possibly damaging Het
C2cd6 T C 1: 59,094,833 R10G possibly damaging Het
Cacna2d1 A G 5: 16,302,354 E367G possibly damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cd2 A T 3: 101,287,499 M91K possibly damaging Het
Cdc16 C A 8: 13,764,688 Y157* probably null Het
Celsr3 G T 9: 108,831,857 V1301F probably damaging Het
Cep164 C T 9: 45,792,937 G961S probably damaging Het
Cep290 T C 10: 100,513,981 V630A probably benign Het
Chd5 C T 4: 152,378,815 S1451F probably damaging Het
Cldn23 A C 8: 35,825,986 L116R possibly damaging Het
Cngb1 A T 8: 95,297,773 probably benign Het
Cpb1 G T 3: 20,266,241 N151K possibly damaging Het
Cpn2 A G 16: 30,260,100 F261S probably damaging Het
Crlf3 A C 11: 80,057,872 V249G probably damaging Het
Csmd1 A T 8: 16,157,120 Y1298* probably null Het
Cstf2t C A 19: 31,083,685 P207Q possibly damaging Het
Cym A C 3: 107,213,425 L288R possibly damaging Het
Cyp2j12 C T 4: 96,121,432 probably null Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dnah7b T C 1: 46,322,335 F3465S probably damaging Het
Dnmt3a A T 12: 3,873,342 M181L possibly damaging Het
Eif2b4 A T 5: 31,192,940 S13T probably benign Het
Ercc6 T C 14: 32,576,999 V1448A probably benign Het
Esp24 A G 17: 39,040,002 E31G possibly damaging Het
F2rl2 T A 13: 95,701,461 M338K probably benign Het
Fgfbp1 A C 5: 43,979,923 L9R possibly damaging Het
Gal3st2b A T 1: 93,940,616 N188Y probably damaging Het
Gpr179 G C 11: 97,346,578 C372W probably damaging Het
Grn T G 11: 102,433,267 C61G probably damaging Het
Herc1 T G 9: 66,469,010 C3371G probably damaging Het
Herc1 T C 9: 66,502,084 probably null Het
Hmcn1 C T 1: 150,586,468 G5153D possibly damaging Het
Ifi35 A T 11: 101,456,635 R31W probably damaging Het
Ifit1bl1 T A 19: 34,593,860 H399L probably benign Het
Irx3 G A 8: 91,800,734 P114L probably damaging Het
Kat6a T A 8: 22,935,797 D1119E probably benign Het
Kmt2d G T 15: 98,843,482 probably benign Het
Kng1 A T 16: 23,079,119 H423L possibly damaging Het
Lrp2 T A 2: 69,496,489 Q1746L possibly damaging Het
Lrrc29 A T 8: 105,313,192 V517E probably damaging Het
Lrrc63 A T 14: 75,086,344 probably null Het
Mad2l1 T A 6: 66,539,813 V163E possibly damaging Het
Map3k19 A G 1: 127,822,680 M978T probably benign Het
Mon1a A C 9: 107,901,363 N262T probably damaging Het
Mpo A G 11: 87,795,881 N85D probably benign Het
Mpp4 T C 1: 59,144,810 D244G probably null Het
Mstn A G 1: 53,066,558 Y353C probably damaging Het
Mx1 T A 16: 97,454,158 N232Y probably damaging Het
Mycs T C X: 5,468,103 R308G probably benign Het
Myh11 A T 16: 14,277,870 D9E probably benign Het
Nfe2l3 A T 6: 51,433,412 Q169L probably null Het
Nr5a1 G T 2: 38,708,419 T122N possibly damaging Het
Nras A G 3: 103,058,979 T20A probably damaging Het
Obp2b T A 2: 25,738,640 probably null Het
Olfr1109 T C 2: 87,093,227 T57A probably damaging Het
Olfr1143 T A 2: 87,802,762 F124L probably benign Het
Olfr1410 G A 1: 92,608,400 V188M probably benign Het
Olfr365 A G 2: 37,201,427 Y62C probably damaging Het
Olfr577 T C 7: 102,973,056 N312S probably benign Het
Pcdh17 A T 14: 84,477,654 T920S probably benign Het
Pcdh9 T C 14: 93,887,225 D503G probably benign Het
Pcdhb12 C T 18: 37,436,671 T290I probably damaging Het
Pde6b C A 5: 108,388,691 C84* probably null Het
Pex1 A T 5: 3,630,044 N914I probably damaging Het
Pign A G 1: 105,589,317 V528A possibly damaging Het
Pkhd1 T G 1: 20,533,905 D1187A possibly damaging Het
Ppip5k1 T C 2: 121,342,631 K489E probably damaging Het
Prob1 T C 18: 35,653,252 T650A possibly damaging Het
Radil T C 5: 142,495,336 Y572C probably damaging Het
Rapgef2 A G 3: 79,088,791 I555T possibly damaging Het
Rgs5 G A 1: 169,682,817 probably null Het
Rnaset2b G A 17: 6,981,107 probably null Het
S1pr1 A G 3: 115,711,938 S336P probably benign Het
Slc24a5 A G 2: 125,083,195 E252G possibly damaging Het
Slc34a2 A T 5: 53,061,391 I184F probably benign Het
Slc35a3 A G 3: 116,677,948 V224A possibly damaging Het
Slc39a9 A G 12: 80,677,202 H211R probably damaging Het
Slu7 A G 11: 43,439,268 N174S probably benign Het
Smarcd3 A T 5: 24,595,822 Y131* probably null Het
Syne1 A G 10: 5,367,621 M491T probably benign Het
Tars G A 15: 11,394,243 Q103* probably null Het
Tmem132d C A 5: 127,789,855 E660D probably benign Het
Ttn T C 2: 76,745,043 T16842A probably damaging Het
Ttn T A 2: 76,752,261 M22763L probably benign Het
Ttn T C 2: 76,812,972 E13201G probably damaging Het
Ubp1 A T 9: 113,955,969 I117L possibly damaging Het
Usp24 T A 4: 106,377,559 H954Q probably benign Het
Vmn1r174 G A 7: 23,754,197 R96H probably benign Het
Vmn2r63 G A 7: 42,928,245 Q290* probably null Het
Vnn3 T C 10: 23,865,820 I341T probably benign Het
Wbp2nl A G 15: 82,305,744 T46A probably damaging Het
Wdr48 G T 9: 119,924,247 E625* probably null Het
Wdr6 C T 9: 108,575,164 V507I probably damaging Het
Zp2 A T 7: 120,138,105 W287R probably benign Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
Vaguely UTSW 2 122326135 nonsense probably null
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 splice site probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
R7410:Duox1 UTSW 2 122346393 missense probably damaging 1.00
R7421:Duox1 UTSW 2 122323230 missense probably damaging 1.00
R7608:Duox1 UTSW 2 122326135 nonsense probably null
R7702:Duox1 UTSW 2 122329639 missense possibly damaging 0.86
R7766:Duox1 UTSW 2 122337301 missense probably benign
R7833:Duox1 UTSW 2 122324388 missense probably damaging 1.00
R7980:Duox1 UTSW 2 122347320 missense possibly damaging 0.71
R8275:Duox1 UTSW 2 122344768 missense probably benign 0.02
Z1176:Duox1 UTSW 2 122333038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAGACAGAAGTGGGCTACTGATG -3'
(R):5'- AGCATGAAGTGGAAGTCCTCCCAG -3'

Sequencing Primer
(F):5'- ATGTTGTATTGGAGATAGAGAGCC -3'
(R):5'- TTGTCCTGGAAGCCAGACTC -3'
Posted On2014-05-23