Mutagenetix > Incidental Mutations

Incidental Mutation 'R1753:Chd5'

193718

Institutional Source

Beutler Lab

Gene Symbol

Chd5

Ensembl Gene

ENSMUSG00000005045

Gene Name

chromodomain helicase DNA binding protein 5

Synonyms

MMRRC Submission

039785-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1753 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

152338651-152390194 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 152378815 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 1451 (S1451F)

Ref Sequence

ENSEMBL: ENSMUSP00000030775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005175] [ENSMUST00000030775] [ENSMUST00000164662]

Predicted Effect

probably benign
Transcript: ENSMUST00000005175
AA Change: S1451F

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000005175
Gene: ENSMUSG00000005045
AA Change: S1451F

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
Pfam:CHDNT	149	203	2e-32	PFAM
low complexity region	209	220	N/A	INTRINSIC
low complexity region	256	273	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
PHD	347	390	1.09e-14	SMART
RING	348	389	4.48e-1	SMART
low complexity region	400	416	N/A	INTRINSIC
PHD	420	463	3.29e-14	SMART
RING	421	462	4.15e0	SMART
CHROMO	468	548	2.52e-13	SMART
CHROMO	592	649	1.34e-8	SMART
low complexity region	657	678	N/A	INTRINSIC
DEXDc	698	910	8.34e-33	SMART
low complexity region	1023	1038	N/A	INTRINSIC
HELICc	1056	1140	4.02e-26	SMART
DUF1087	1297	1361	2.78e-33	SMART
DUF1086	1374	1533	5.11e-105	SMART
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1685	1701	N/A	INTRINSIC
Pfam:CHDCT2	1729	1901	1.7e-99	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000030775
AA Change: S1451F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030775
Gene: ENSMUSG00000005045
AA Change: S1451F

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
Pfam:CHDNT	150	203	9e-28	PFAM
low complexity region	209	220	N/A	INTRINSIC
low complexity region	256	273	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
PHD	347	390	1.09e-14	SMART
RING	348	389	4.48e-1	SMART
low complexity region	400	416	N/A	INTRINSIC
PHD	420	463	3.29e-14	SMART
RING	421	462	4.15e0	SMART
CHROMO	468	548	2.52e-13	SMART
CHROMO	592	649	1.34e-8	SMART
low complexity region	657	678	N/A	INTRINSIC
DEXDc	698	910	8.34e-33	SMART
low complexity region	1023	1038	N/A	INTRINSIC
HELICc	1056	1140	4.02e-26	SMART
DUF1087	1297	1361	2.78e-33	SMART
DUF1086	1374	1533	5.11e-105	SMART
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1685	1701	N/A	INTRINSIC
Pfam:CHDCT2	1730	1901	2.8e-93	PFAM
low complexity region	1922	1936	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124423

Predicted Effect

probably damaging
Transcript: ENSMUST00000164662
AA Change: S1414F

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132600
Gene: ENSMUSG00000005045
AA Change: S1414F

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
Pfam:CHDNT	149	203	1.9e-32	PFAM
low complexity region	209	220	N/A	INTRINSIC
low complexity region	256	273	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
PHD	347	390	1.09e-14	SMART
RING	348	389	4.48e-1	SMART
low complexity region	400	416	N/A	INTRINSIC
PHD	420	463	3.29e-14	SMART
RING	421	462	4.15e0	SMART
CHROMO	468	548	2.52e-13	SMART
CHROMO	592	649	1.34e-8	SMART
low complexity region	657	678	N/A	INTRINSIC
DEXDc	698	910	8.34e-33	SMART
low complexity region	1023	1038	N/A	INTRINSIC
HELICc	1056	1140	4.02e-26	SMART
DUF1087	1260	1324	2.78e-33	SMART
DUF1086	1337	1496	5.11e-105	SMART
low complexity region	1515	1530	N/A	INTRINSIC
low complexity region	1648	1664	N/A	INTRINSIC
Pfam:CHDCT2	1692	1864	1.7e-99	PFAM
low complexity region	1885	1899	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromodomain helicase DNA-binding protein family. Members of this family are characterized by a chromodomain, a helicase ATP-binding domain and an additional functional domain. This gene encodes a neuron-specific protein that may function in chromatin remodeling and gene transcription. This gene is a potential tumor suppressor gene that may play a role in the development of neuroblastoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with abnormal spermiogenesis and chromatin condensation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	T	11: 109,973,716	F409I	probably benign	Het
Adamts19	A	C	18: 59,007,372	I848L	possibly damaging	Het
Adamts5	T	C	16: 85,899,352	S306G	probably damaging	Het
Adamts8	T	G	9: 30,954,614	I486S	probably benign	Het
Adgrg5	T	C	8: 94,942,052	F499L	possibly damaging	Het
Akr1c21	T	A	13: 4,577,135	C145*	probably null	Het
Anp32b	T	G	4: 46,460,241		probably null	Het
Arhgap31	A	G	16: 38,601,612	V1364A	possibly damaging	Het
C2cd6	T	C	1: 59,094,833	R10G	possibly damaging	Het
Cacna2d1	A	G	5: 16,302,354	E367G	possibly damaging	Het
Ccdc81	C	T	7: 89,866,561	E637K	probably benign	Het
Cd2	A	T	3: 101,287,499	M91K	possibly damaging	Het
Cdc16	C	A	8: 13,764,688	Y157*	probably null	Het
Celsr3	G	T	9: 108,831,857	V1301F	probably damaging	Het
Cep164	C	T	9: 45,792,937	G961S	probably damaging	Het
Cep290	T	C	10: 100,513,981	V630A	probably benign	Het
Cldn23	A	C	8: 35,825,986	L116R	possibly damaging	Het
Cngb1	A	T	8: 95,297,773		probably benign	Het
Cpb1	G	T	3: 20,266,241	N151K	possibly damaging	Het
Cpn2	A	G	16: 30,260,100	F261S	probably damaging	Het
Crlf3	A	C	11: 80,057,872	V249G	probably damaging	Het
Csmd1	A	T	8: 16,157,120	Y1298*	probably null	Het
Cstf2t	C	A	19: 31,083,685	P207Q	possibly damaging	Het
Cym	A	C	3: 107,213,425	L288R	possibly damaging	Het
Cyp2j12	C	T	4: 96,121,432		probably null	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dnah7b	T	C	1: 46,322,335	F3465S	probably damaging	Het
Dnmt3a	A	T	12: 3,873,342	M181L	possibly damaging	Het
Duox1	T	A	2: 122,333,429	M859K	probably damaging	Het
Eif2b4	A	T	5: 31,192,940	S13T	probably benign	Het
Ercc6	T	C	14: 32,576,999	V1448A	probably benign	Het
Esp24	A	G	17: 39,040,002	E31G	possibly damaging	Het
F2rl2	T	A	13: 95,701,461	M338K	probably benign	Het
Fgfbp1	A	C	5: 43,979,923	L9R	possibly damaging	Het
Gal3st2b	A	T	1: 93,940,616	N188Y	probably damaging	Het
Gpr179	G	C	11: 97,346,578	C372W	probably damaging	Het
Grn	T	G	11: 102,433,267	C61G	probably damaging	Het
Herc1	T	G	9: 66,469,010	C3371G	probably damaging	Het
Herc1	T	C	9: 66,502,084		probably null	Het
Hmcn1	C	T	1: 150,586,468	G5153D	possibly damaging	Het
Ifi35	A	T	11: 101,456,635	R31W	probably damaging	Het
Ifit1bl1	T	A	19: 34,593,860	H399L	probably benign	Het
Irx3	G	A	8: 91,800,734	P114L	probably damaging	Het
Kat6a	T	A	8: 22,935,797	D1119E	probably benign	Het
Kmt2d	G	T	15: 98,843,482		probably benign	Het
Kng1	A	T	16: 23,079,119	H423L	possibly damaging	Het
Lrp2	T	A	2: 69,496,489	Q1746L	possibly damaging	Het
Lrrc29	A	T	8: 105,313,192	V517E	probably damaging	Het
Lrrc63	A	T	14: 75,086,344		probably null	Het
Mad2l1	T	A	6: 66,539,813	V163E	possibly damaging	Het
Map3k19	A	G	1: 127,822,680	M978T	probably benign	Het
Mon1a	A	C	9: 107,901,363	N262T	probably damaging	Het
Mpo	A	G	11: 87,795,881	N85D	probably benign	Het
Mpp4	T	C	1: 59,144,810	D244G	probably null	Het
Mstn	A	G	1: 53,066,558	Y353C	probably damaging	Het
Mx1	T	A	16: 97,454,158	N232Y	probably damaging	Het
Mycs	T	C	X: 5,468,103	R308G	probably benign	Het
Myh11	A	T	16: 14,277,870	D9E	probably benign	Het
Nfe2l3	A	T	6: 51,433,412	Q169L	probably null	Het
Nr5a1	G	T	2: 38,708,419	T122N	possibly damaging	Het
Nras	A	G	3: 103,058,979	T20A	probably damaging	Het
Obp2b	T	A	2: 25,738,640		probably null	Het
Olfr1109	T	C	2: 87,093,227	T57A	probably damaging	Het
Olfr1143	T	A	2: 87,802,762	F124L	probably benign	Het
Olfr1410	G	A	1: 92,608,400	V188M	probably benign	Het
Olfr365	A	G	2: 37,201,427	Y62C	probably damaging	Het
Olfr577	T	C	7: 102,973,056	N312S	probably benign	Het
Pcdh17	A	T	14: 84,477,654	T920S	probably benign	Het
Pcdh9	T	C	14: 93,887,225	D503G	probably benign	Het
Pcdhb12	C	T	18: 37,436,671	T290I	probably damaging	Het
Pde6b	C	A	5: 108,388,691	C84*	probably null	Het
Pex1	A	T	5: 3,630,044	N914I	probably damaging	Het
Pign	A	G	1: 105,589,317	V528A	possibly damaging	Het
Pkhd1	T	G	1: 20,533,905	D1187A	possibly damaging	Het
Ppip5k1	T	C	2: 121,342,631	K489E	probably damaging	Het
Prob1	T	C	18: 35,653,252	T650A	possibly damaging	Het
Radil	T	C	5: 142,495,336	Y572C	probably damaging	Het
Rapgef2	A	G	3: 79,088,791	I555T	possibly damaging	Het
Rgs5	G	A	1: 169,682,817		probably null	Het
Rnaset2b	G	A	17: 6,981,107		probably null	Het
S1pr1	A	G	3: 115,711,938	S336P	probably benign	Het
Slc24a5	A	G	2: 125,083,195	E252G	possibly damaging	Het
Slc34a2	A	T	5: 53,061,391	I184F	probably benign	Het
Slc35a3	A	G	3: 116,677,948	V224A	possibly damaging	Het
Slc39a9	A	G	12: 80,677,202	H211R	probably damaging	Het
Slu7	A	G	11: 43,439,268	N174S	probably benign	Het
Smarcd3	A	T	5: 24,595,822	Y131*	probably null	Het
Syne1	A	G	10: 5,367,621	M491T	probably benign	Het
Tars	G	A	15: 11,394,243	Q103*	probably null	Het
Tmem132d	C	A	5: 127,789,855	E660D	probably benign	Het
Ttn	T	C	2: 76,745,043	T16842A	probably damaging	Het
Ttn	T	A	2: 76,752,261	M22763L	probably benign	Het
Ttn	T	C	2: 76,812,972	E13201G	probably damaging	Het
Ubp1	A	T	9: 113,955,969	I117L	possibly damaging	Het
Usp24	T	A	4: 106,377,559	H954Q	probably benign	Het
Vmn1r174	G	A	7: 23,754,197	R96H	probably benign	Het
Vmn2r63	G	A	7: 42,928,245	Q290*	probably null	Het
Vnn3	T	C	10: 23,865,820	I341T	probably benign	Het
Wbp2nl	A	G	15: 82,305,744	T46A	probably damaging	Het
Wdr48	G	T	9: 119,924,247	E625*	probably null	Het
Wdr6	C	T	9: 108,575,164	V507I	probably damaging	Het
Zp2	A	T	7: 120,138,105	W287R	probably benign	Het

Other mutations in Chd5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Chd5	APN	4	152360602	missense	probably damaging	1.00
IGL00886:Chd5	APN	4	152359699	missense	probably benign	0.00
IGL00963:Chd5	APN	4	152382938	missense	probably damaging	1.00
IGL01399:Chd5	APN	4	152356687	missense	probably damaging	1.00
IGL01571:Chd5	APN	4	152384115	splice site	probably benign
IGL01606:Chd5	APN	4	152360975	missense	probably damaging	0.99
IGL01636:Chd5	APN	4	152384653	nonsense	probably null
IGL02009:Chd5	APN	4	152366213	missense	probably damaging	1.00
IGL02417:Chd5	APN	4	152367294	missense	probably damaging	0.97
IGL02504:Chd5	APN	4	152363322	missense	probably damaging	0.99
IGL02508:Chd5	APN	4	152363024	missense	probably damaging	1.00
IGL02597:Chd5	APN	4	152371712	missense	probably damaging	1.00
IGL02608:Chd5	APN	4	152356107	missense	possibly damaging	0.94
IGL02612:Chd5	APN	4	152360576	missense	probably damaging	1.00
IGL02658:Chd5	APN	4	152360593	missense	probably damaging	1.00
IGL02662:Chd5	APN	4	152372131	missense	probably damaging	1.00
IGL02676:Chd5	APN	4	152356073	splice site	probably benign
IGL02871:Chd5	APN	4	152376685	missense	probably damaging	1.00
IGL02942:Chd5	APN	4	152385725	missense	probably damaging	0.98
IGL02956:Chd5	APN	4	152379956	missense	probably benign	0.00
IGL03286:Chd5	APN	4	152385495	missense	probably benign	0.00
IGL03348:Chd5	APN	4	152376685	missense	probably damaging	1.00
IGL03398:Chd5	APN	4	152377082	missense	probably damaging	0.97
PIT1430001:Chd5	UTSW	4	152370637	missense	probably damaging	1.00
PIT4151001:Chd5	UTSW	4	152378529	missense	probably damaging	0.99
R0079:Chd5	UTSW	4	152385749	missense	probably damaging	1.00
R0241:Chd5	UTSW	4	152366132	missense	probably damaging	1.00
R0241:Chd5	UTSW	4	152366132	missense	probably damaging	1.00
R0379:Chd5	UTSW	4	152383321	missense	probably benign	0.00
R0388:Chd5	UTSW	4	152371644	missense	probably damaging	1.00
R0675:Chd5	UTSW	4	152385950	missense	probably benign	0.06
R0730:Chd5	UTSW	4	152347984	missense	possibly damaging	0.72
R0799:Chd5	UTSW	4	152384159	missense	probably damaging	1.00
R0800:Chd5	UTSW	4	152356157	missense	probably damaging	1.00
R1276:Chd5	UTSW	4	152378734	missense	probably damaging	1.00
R1752:Chd5	UTSW	4	152375133	missense	probably damaging	1.00
R1843:Chd5	UTSW	4	152385806	missense	probably damaging	1.00
R1850:Chd5	UTSW	4	152370533	missense	probably damaging	1.00
R1851:Chd5	UTSW	4	152378270	missense	probably damaging	0.97
R1859:Chd5	UTSW	4	152380523	missense	probably benign	0.00
R1983:Chd5	UTSW	4	152384666	missense	possibly damaging	0.89
R2404:Chd5	UTSW	4	152367334	missense	probably damaging	1.00
R2897:Chd5	UTSW	4	152372115	missense	probably damaging	1.00
R2898:Chd5	UTSW	4	152372115	missense	probably damaging	1.00
R3893:Chd5	UTSW	4	152360656	missense	probably damaging	1.00
R3938:Chd5	UTSW	4	152377055	missense	probably benign	0.05
R4707:Chd5	UTSW	4	152360582	missense	probably damaging	1.00
R4754:Chd5	UTSW	4	152377746	missense	probably damaging	0.99
R4911:Chd5	UTSW	4	152360672	missense	probably damaging	1.00
R4924:Chd5	UTSW	4	152366429	missense	possibly damaging	0.50
R4926:Chd5	UTSW	4	152383311	missense	probably benign	0.00
R5256:Chd5	UTSW	4	152372097	missense	probably benign	0.01
R5524:Chd5	UTSW	4	152376630	missense	probably benign
R5552:Chd5	UTSW	4	152385815	missense	possibly damaging	0.95
R5895:Chd5	UTSW	4	152379932	missense	probably benign	0.13
R5945:Chd5	UTSW	4	152379951	missense	probably benign
R6007:Chd5	UTSW	4	152379421	missense	probably null	1.00
R6039:Chd5	UTSW	4	152353621	small deletion	probably benign
R6039:Chd5	UTSW	4	152353621	small deletion	probably benign
R6172:Chd5	UTSW	4	152379391	missense	probably damaging	1.00
R6173:Chd5	UTSW	4	152379391	missense	probably damaging	1.00
R6323:Chd5	UTSW	4	152367334	missense	probably damaging	0.99
R6331:Chd5	UTSW	4	152382408	missense	probably benign	0.02
R6495:Chd5	UTSW	4	152367372	missense	probably damaging	1.00
R6528:Chd5	UTSW	4	152356676	missense	probably damaging	1.00
R6849:Chd5	UTSW	4	152378538	missense	probably damaging	1.00
R6854:Chd5	UTSW	4	152382938	missense	probably damaging	1.00
R6859:Chd5	UTSW	4	152378207	missense	probably damaging	1.00
R6999:Chd5	UTSW	4	152374434	missense	probably damaging	1.00
R7034:Chd5	UTSW	4	152360941	missense	possibly damaging	0.89
R7110:Chd5	UTSW	4	152385439	missense	probably damaging	1.00
R7361:Chd5	UTSW	4	152363288	missense	probably damaging	0.99
R7397:Chd5	UTSW	4	152368012	missense	possibly damaging	0.82
R7440:Chd5	UTSW	4	152384651	missense	probably benign	0.01
R7489:Chd5	UTSW	4	152373468	missense	probably damaging	1.00
R7810:Chd5	UTSW	4	152358575	missense	probably damaging	0.97
R8057:Chd5	UTSW	4	152366372	missense	probably damaging	1.00
R8078:Chd5	UTSW	4	152360991	missense	possibly damaging	0.90
R8092:Chd5	UTSW	4	152378804	missense	probably damaging	0.99
R8170:Chd5	UTSW	4	152376583	missense	probably benign	0.26
R8255:Chd5	UTSW	4	152379423	missense	probably damaging	0.99
R8348:Chd5	UTSW	4	152360716	missense	probably damaging	0.98
R8448:Chd5	UTSW	4	152360716	missense	probably damaging	0.98
R8478:Chd5	UTSW	4	152356690	nonsense	probably null
R8482:Chd5	UTSW	4	152356690	nonsense	probably null
Z1176:Chd5	UTSW	4	152378479	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACCTCTGGGTTTAAGTGTTCCTTGC -3'
(R):5'- CAGCACTATCCCAAAGAGTATGGGC -3'

Sequencing Primer
(F):5'- GGTTTAAGTGTTCCTTGCTCTTC -3'
(R):5'- GGCGGTATTTTCTATAAATCAGCCC -3'

Posted On

2014-05-23