Incidental Mutation 'R1753:Vmn2r63'
ID 193736
Institutional Source Beutler Lab
Gene Symbol Vmn2r63
Ensembl Gene ENSMUSG00000090751
Gene Name vomeronasal 2, receptor 63
Synonyms EG435975
MMRRC Submission 039785-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R1753 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 42552675-42583213 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 42577669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 290 (Q290*)
Ref Sequence ENSEMBL: ENSMUSP00000129089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163803]
AlphaFold E9Q0K5
Predicted Effect probably null
Transcript: ENSMUST00000163803
AA Change: Q290*
SMART Domains Protein: ENSMUSP00000129089
Gene: ENSMUSG00000090751
AA Change: Q290*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 3.5e-43 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 3.5e-51 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,864,542 (GRCm39) F409I probably benign Het
Adamts19 A C 18: 59,140,444 (GRCm39) I848L possibly damaging Het
Adamts5 T C 16: 85,696,240 (GRCm39) S306G probably damaging Het
Adamts8 T G 9: 30,865,910 (GRCm39) I486S probably benign Het
Adgrg5 T C 8: 95,668,680 (GRCm39) F499L possibly damaging Het
Akr1c21 T A 13: 4,627,134 (GRCm39) C145* probably null Het
Anp32b T G 4: 46,460,241 (GRCm39) probably null Het
Arhgap31 A G 16: 38,421,974 (GRCm39) V1364A possibly damaging Het
C2cd6 T C 1: 59,133,992 (GRCm39) R10G possibly damaging Het
Cacna2d1 A G 5: 16,507,352 (GRCm39) E367G possibly damaging Het
Ccdc81 C T 7: 89,515,769 (GRCm39) E637K probably benign Het
Cd2 A T 3: 101,194,815 (GRCm39) M91K possibly damaging Het
Cdc16 C A 8: 13,814,688 (GRCm39) Y157* probably null Het
Celsr3 G T 9: 108,709,056 (GRCm39) V1301F probably damaging Het
Cep164 C T 9: 45,704,235 (GRCm39) G961S probably damaging Het
Cep290 T C 10: 100,349,843 (GRCm39) V630A probably benign Het
Chd5 C T 4: 152,463,272 (GRCm39) S1451F probably damaging Het
Cldn23 A C 8: 36,293,140 (GRCm39) L116R possibly damaging Het
Cngb1 A T 8: 96,024,401 (GRCm39) probably benign Het
Cpb1 G T 3: 20,320,405 (GRCm39) N151K possibly damaging Het
Cpn2 A G 16: 30,078,918 (GRCm39) F261S probably damaging Het
Crlf3 A C 11: 79,948,698 (GRCm39) V249G probably damaging Het
Csmd1 A T 8: 16,207,134 (GRCm39) Y1298* probably null Het
Cstf2t C A 19: 31,061,085 (GRCm39) P207Q possibly damaging Het
Cym A C 3: 107,120,741 (GRCm39) L288R possibly damaging Het
Cyp2j12 C T 4: 96,009,669 (GRCm39) probably null Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dnah7b T C 1: 46,361,495 (GRCm39) F3465S probably damaging Het
Dnmt3a A T 12: 3,923,342 (GRCm39) M181L possibly damaging Het
Duox1 T A 2: 122,163,910 (GRCm39) M859K probably damaging Het
Eif2b4 A T 5: 31,350,284 (GRCm39) S13T probably benign Het
Ercc6 T C 14: 32,298,956 (GRCm39) V1448A probably benign Het
Esp24 A G 17: 39,350,893 (GRCm39) E31G possibly damaging Het
F2rl2 T A 13: 95,837,969 (GRCm39) M338K probably benign Het
Fbxl9 A T 8: 106,039,824 (GRCm39) V517E probably damaging Het
Fgfbp1 A C 5: 44,137,265 (GRCm39) L9R possibly damaging Het
Gal3st2b A T 1: 93,868,338 (GRCm39) N188Y probably damaging Het
Gpr179 G C 11: 97,237,404 (GRCm39) C372W probably damaging Het
Grn T G 11: 102,324,093 (GRCm39) C61G probably damaging Het
Herc1 T G 9: 66,376,292 (GRCm39) C3371G probably damaging Het
Herc1 T C 9: 66,409,366 (GRCm39) probably null Het
Hmcn1 C T 1: 150,462,219 (GRCm39) G5153D possibly damaging Het
Ifi35 A T 11: 101,347,461 (GRCm39) R31W probably damaging Het
Ifit1bl1 T A 19: 34,571,260 (GRCm39) H399L probably benign Het
Irx3 G A 8: 92,527,362 (GRCm39) P114L probably damaging Het
Kat6a T A 8: 23,425,813 (GRCm39) D1119E probably benign Het
Kmt2d G T 15: 98,741,363 (GRCm39) probably benign Het
Kng1 A T 16: 22,897,869 (GRCm39) H423L possibly damaging Het
Lrp2 T A 2: 69,326,833 (GRCm39) Q1746L possibly damaging Het
Lrrc63 A T 14: 75,323,784 (GRCm39) probably null Het
Mad2l1 T A 6: 66,516,797 (GRCm39) V163E possibly damaging Het
Map3k19 A G 1: 127,750,417 (GRCm39) M978T probably benign Het
Mon1a A C 9: 107,778,562 (GRCm39) N262T probably damaging Het
Mpo A G 11: 87,686,707 (GRCm39) N85D probably benign Het
Mpp4 T C 1: 59,183,969 (GRCm39) D244G probably null Het
Mstn A G 1: 53,105,717 (GRCm39) Y353C probably damaging Het
Mx1 T A 16: 97,255,358 (GRCm39) N232Y probably damaging Het
Mycs T C X: 5,380,157 (GRCm39) R308G probably benign Het
Myh11 A T 16: 14,095,734 (GRCm39) D9E probably benign Het
Nfe2l3 A T 6: 51,410,392 (GRCm39) Q169L probably null Het
Nr5a1 G T 2: 38,598,431 (GRCm39) T122N possibly damaging Het
Nras A G 3: 102,966,295 (GRCm39) T20A probably damaging Het
Obp2b T A 2: 25,628,652 (GRCm39) probably null Het
Or1l4 A G 2: 37,091,439 (GRCm39) Y62C probably damaging Het
Or51g2 T C 7: 102,622,263 (GRCm39) N312S probably benign Het
Or5aq6 T C 2: 86,923,571 (GRCm39) T57A probably damaging Het
Or5w18 T A 2: 87,633,106 (GRCm39) F124L probably benign Het
Or9s14 G A 1: 92,536,122 (GRCm39) V188M probably benign Het
Pcdh17 A T 14: 84,715,094 (GRCm39) T920S probably benign Het
Pcdh9 T C 14: 94,124,661 (GRCm39) D503G probably benign Het
Pcdhb12 C T 18: 37,569,724 (GRCm39) T290I probably damaging Het
Pde6b C A 5: 108,536,557 (GRCm39) C84* probably null Het
Pex1 A T 5: 3,680,044 (GRCm39) N914I probably damaging Het
Pign A G 1: 105,517,042 (GRCm39) V528A possibly damaging Het
Pkhd1 T G 1: 20,604,129 (GRCm39) D1187A possibly damaging Het
Ppip5k1 T C 2: 121,173,112 (GRCm39) K489E probably damaging Het
Prob1 T C 18: 35,786,305 (GRCm39) T650A possibly damaging Het
Radil T C 5: 142,481,091 (GRCm39) Y572C probably damaging Het
Rapgef2 A G 3: 78,996,098 (GRCm39) I555T possibly damaging Het
Rgs5 G A 1: 169,510,386 (GRCm39) probably null Het
Rnaset2b G A 17: 7,248,506 (GRCm39) probably null Het
S1pr1 A G 3: 115,505,587 (GRCm39) S336P probably benign Het
Slc24a5 A G 2: 124,925,115 (GRCm39) E252G possibly damaging Het
Slc34a2 A T 5: 53,218,733 (GRCm39) I184F probably benign Het
Slc35a3 A G 3: 116,471,597 (GRCm39) V224A possibly damaging Het
Slc39a9 A G 12: 80,723,976 (GRCm39) H211R probably damaging Het
Slu7 A G 11: 43,330,095 (GRCm39) N174S probably benign Het
Smarcd3 A T 5: 24,800,820 (GRCm39) Y131* probably null Het
Syne1 A G 10: 5,317,621 (GRCm39) M491T probably benign Het
Tars1 G A 15: 11,394,329 (GRCm39) Q103* probably null Het
Tmem132d C A 5: 127,866,919 (GRCm39) E660D probably benign Het
Ttn T C 2: 76,575,387 (GRCm39) T16842A probably damaging Het
Ttn T C 2: 76,643,316 (GRCm39) E13201G probably damaging Het
Ttn T A 2: 76,582,605 (GRCm39) M22763L probably benign Het
Ubp1 A T 9: 113,785,037 (GRCm39) I117L possibly damaging Het
Usp24 T A 4: 106,234,756 (GRCm39) H954Q probably benign Het
Vmn1r174 G A 7: 23,453,622 (GRCm39) R96H probably benign Het
Vnn3 T C 10: 23,741,718 (GRCm39) I341T probably benign Het
Wbp2nl A G 15: 82,189,945 (GRCm39) T46A probably damaging Het
Wdr48 G T 9: 119,753,313 (GRCm39) E625* probably null Het
Wdr6 C T 9: 108,452,363 (GRCm39) V507I probably damaging Het
Zp2 A T 7: 119,737,328 (GRCm39) W287R probably benign Het
Other mutations in Vmn2r63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Vmn2r63 APN 7 42,553,543 (GRCm39) missense probably damaging 0.99
IGL01765:Vmn2r63 APN 7 42,552,788 (GRCm39) missense probably benign
IGL02203:Vmn2r63 APN 7 42,553,432 (GRCm39) missense probably benign 0.01
IGL02825:Vmn2r63 APN 7 42,576,274 (GRCm39) critical splice donor site probably null
IGL03155:Vmn2r63 APN 7 42,552,878 (GRCm39) missense probably damaging 1.00
IGL03260:Vmn2r63 APN 7 42,578,616 (GRCm39) missense probably damaging 1.00
IGL03411:Vmn2r63 APN 7 42,577,368 (GRCm39) missense probably benign 0.42
PIT4280001:Vmn2r63 UTSW 7 42,553,409 (GRCm39) missense probably damaging 1.00
R0066:Vmn2r63 UTSW 7 42,576,514 (GRCm39) splice site probably benign
R0328:Vmn2r63 UTSW 7 42,552,699 (GRCm39) missense probably benign 0.09
R0344:Vmn2r63 UTSW 7 42,553,042 (GRCm39) missense probably damaging 0.98
R0554:Vmn2r63 UTSW 7 42,583,129 (GRCm39) nonsense probably null
R0555:Vmn2r63 UTSW 7 42,577,952 (GRCm39) nonsense probably null
R0685:Vmn2r63 UTSW 7 42,577,434 (GRCm39) missense probably benign 0.13
R0751:Vmn2r63 UTSW 7 42,577,459 (GRCm39) missense probably damaging 1.00
R1349:Vmn2r63 UTSW 7 42,578,642 (GRCm39) missense possibly damaging 0.95
R1372:Vmn2r63 UTSW 7 42,578,642 (GRCm39) missense possibly damaging 0.95
R1416:Vmn2r63 UTSW 7 42,577,339 (GRCm39) missense probably benign 0.00
R1502:Vmn2r63 UTSW 7 42,578,015 (GRCm39) missense possibly damaging 0.62
R1563:Vmn2r63 UTSW 7 42,553,550 (GRCm39) missense probably benign 0.00
R1652:Vmn2r63 UTSW 7 42,577,635 (GRCm39) missense probably benign 0.32
R1693:Vmn2r63 UTSW 7 42,577,743 (GRCm39) missense probably benign
R1698:Vmn2r63 UTSW 7 42,583,038 (GRCm39) missense probably benign
R2136:Vmn2r63 UTSW 7 42,576,297 (GRCm39) missense probably damaging 0.99
R2175:Vmn2r63 UTSW 7 42,583,004 (GRCm39) critical splice donor site probably null
R2261:Vmn2r63 UTSW 7 42,578,031 (GRCm39) missense probably benign 0.02
R2262:Vmn2r63 UTSW 7 42,578,031 (GRCm39) missense probably benign 0.02
R2263:Vmn2r63 UTSW 7 42,578,031 (GRCm39) missense probably benign 0.02
R3413:Vmn2r63 UTSW 7 42,576,406 (GRCm39) missense probably benign 0.04
R3426:Vmn2r63 UTSW 7 42,576,406 (GRCm39) missense probably benign 0.04
R3427:Vmn2r63 UTSW 7 42,576,406 (GRCm39) missense probably benign 0.04
R3802:Vmn2r63 UTSW 7 42,552,829 (GRCm39) missense probably damaging 0.99
R4319:Vmn2r63 UTSW 7 42,576,406 (GRCm39) missense probably benign 0.04
R4321:Vmn2r63 UTSW 7 42,576,406 (GRCm39) missense probably benign 0.04
R4323:Vmn2r63 UTSW 7 42,576,406 (GRCm39) missense probably benign 0.04
R4346:Vmn2r63 UTSW 7 42,577,537 (GRCm39) missense possibly damaging 0.67
R4568:Vmn2r63 UTSW 7 42,583,250 (GRCm39) splice site probably null
R4649:Vmn2r63 UTSW 7 42,553,114 (GRCm39) missense possibly damaging 0.79
R4653:Vmn2r63 UTSW 7 42,553,114 (GRCm39) missense possibly damaging 0.79
R4679:Vmn2r63 UTSW 7 42,577,544 (GRCm39) missense probably benign 0.00
R4734:Vmn2r63 UTSW 7 42,577,544 (GRCm39) missense probably benign 0.00
R4741:Vmn2r63 UTSW 7 42,577,544 (GRCm39) missense probably benign 0.00
R4748:Vmn2r63 UTSW 7 42,577,544 (GRCm39) missense probably benign 0.00
R4806:Vmn2r63 UTSW 7 42,576,314 (GRCm39) missense probably benign 0.34
R4933:Vmn2r63 UTSW 7 42,553,402 (GRCm39) missense probably damaging 1.00
R5198:Vmn2r63 UTSW 7 42,553,169 (GRCm39) missense probably benign 0.01
R5399:Vmn2r63 UTSW 7 42,577,701 (GRCm39) missense probably benign
R5400:Vmn2r63 UTSW 7 42,577,635 (GRCm39) missense probably benign 0.32
R6158:Vmn2r63 UTSW 7 42,583,104 (GRCm39) missense probably damaging 1.00
R6185:Vmn2r63 UTSW 7 42,578,435 (GRCm39) missense probably damaging 0.98
R6267:Vmn2r63 UTSW 7 42,578,059 (GRCm39) splice site probably null
R6362:Vmn2r63 UTSW 7 42,552,721 (GRCm39) missense probably benign
R6706:Vmn2r63 UTSW 7 42,578,001 (GRCm39) missense probably damaging 1.00
R6764:Vmn2r63 UTSW 7 42,552,695 (GRCm39) missense probably damaging 0.97
R7104:Vmn2r63 UTSW 7 42,577,959 (GRCm39) missense possibly damaging 0.67
R7503:Vmn2r63 UTSW 7 42,583,014 (GRCm39) missense probably benign 0.02
R7506:Vmn2r63 UTSW 7 42,576,391 (GRCm39) missense probably damaging 1.00
R7525:Vmn2r63 UTSW 7 42,576,406 (GRCm39) missense possibly damaging 0.52
R7658:Vmn2r63 UTSW 7 42,574,693 (GRCm39) missense probably damaging 1.00
R7663:Vmn2r63 UTSW 7 42,576,466 (GRCm39) missense probably benign 0.00
R7702:Vmn2r63 UTSW 7 42,577,553 (GRCm39) missense possibly damaging 0.46
R7918:Vmn2r63 UTSW 7 42,552,955 (GRCm39) missense probably damaging 1.00
R8826:Vmn2r63 UTSW 7 42,576,441 (GRCm39) missense probably benign 0.38
R8973:Vmn2r63 UTSW 7 42,577,919 (GRCm39) missense probably benign 0.19
R9024:Vmn2r63 UTSW 7 42,577,874 (GRCm39) missense probably benign 0.14
R9154:Vmn2r63 UTSW 7 42,576,413 (GRCm39) missense probably damaging 0.96
R9731:Vmn2r63 UTSW 7 42,553,361 (GRCm39) missense probably benign 0.32
Z1088:Vmn2r63 UTSW 7 42,577,983 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CATTGGGTTGGCAGTTCTCCAAAAG -3'
(R):5'- CTGATTGTCCCAAATGACCCCAGAG -3'

Sequencing Primer
(F):5'- CAGTTCTCCAAAAGTTGGCAATC -3'
(R):5'- CCAGAGGGACTCAGATTCTATCAG -3'
Posted On 2014-05-23