Incidental Mutation 'R1753:Or51g2'
ID 193740
Institutional Source Beutler Lab
Gene Symbol Or51g2
Ensembl Gene ENSMUSG00000043354
Gene Name olfactory receptor family 51 subfamily G member 2
Synonyms Olfr577, GA_x6K02T2PBJ9-5685322-5684384, MOR7-2
MMRRC Submission 039785-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R1753 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 102622259-102623197 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102622263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 312 (N312S)
Ref Sequence ENSEMBL: ENSMUSP00000150712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051505] [ENSMUST00000098213] [ENSMUST00000185326] [ENSMUST00000214080] [ENSMUST00000215237]
AlphaFold Q8VH11
Predicted Effect probably benign
Transcript: ENSMUST00000051505
AA Change: N312S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059586
Gene: ENSMUSG00000043354
AA Change: N312S

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 3.3e-140 PFAM
Pfam:7TM_GPCR_Srsx 38 310 1.2e-6 PFAM
Pfam:7tm_1 44 295 7.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098213
SMART Domains Protein: ENSMUSP00000143172
Gene: ENSMUSG00000073962

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 301 6.2e-12 PFAM
Pfam:7tm_1 41 291 2.5e-29 PFAM
Pfam:7tm_4 140 284 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185326
SMART Domains Protein: ENSMUSP00000142459
Gene: ENSMUSG00000073962

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 300 9.7e-12 PFAM
Pfam:7tm_1 41 291 1.8e-29 PFAM
Pfam:7tm_4 140 284 2.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214080
AA Change: N312S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215237
AA Change: N312S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,864,542 (GRCm39) F409I probably benign Het
Adamts19 A C 18: 59,140,444 (GRCm39) I848L possibly damaging Het
Adamts5 T C 16: 85,696,240 (GRCm39) S306G probably damaging Het
Adamts8 T G 9: 30,865,910 (GRCm39) I486S probably benign Het
Adgrg5 T C 8: 95,668,680 (GRCm39) F499L possibly damaging Het
Akr1c21 T A 13: 4,627,134 (GRCm39) C145* probably null Het
Anp32b T G 4: 46,460,241 (GRCm39) probably null Het
Arhgap31 A G 16: 38,421,974 (GRCm39) V1364A possibly damaging Het
C2cd6 T C 1: 59,133,992 (GRCm39) R10G possibly damaging Het
Cacna2d1 A G 5: 16,507,352 (GRCm39) E367G possibly damaging Het
Ccdc81 C T 7: 89,515,769 (GRCm39) E637K probably benign Het
Cd2 A T 3: 101,194,815 (GRCm39) M91K possibly damaging Het
Cdc16 C A 8: 13,814,688 (GRCm39) Y157* probably null Het
Celsr3 G T 9: 108,709,056 (GRCm39) V1301F probably damaging Het
Cep164 C T 9: 45,704,235 (GRCm39) G961S probably damaging Het
Cep290 T C 10: 100,349,843 (GRCm39) V630A probably benign Het
Chd5 C T 4: 152,463,272 (GRCm39) S1451F probably damaging Het
Cldn23 A C 8: 36,293,140 (GRCm39) L116R possibly damaging Het
Cngb1 A T 8: 96,024,401 (GRCm39) probably benign Het
Cpb1 G T 3: 20,320,405 (GRCm39) N151K possibly damaging Het
Cpn2 A G 16: 30,078,918 (GRCm39) F261S probably damaging Het
Crlf3 A C 11: 79,948,698 (GRCm39) V249G probably damaging Het
Csmd1 A T 8: 16,207,134 (GRCm39) Y1298* probably null Het
Cstf2t C A 19: 31,061,085 (GRCm39) P207Q possibly damaging Het
Cym A C 3: 107,120,741 (GRCm39) L288R possibly damaging Het
Cyp2j12 C T 4: 96,009,669 (GRCm39) probably null Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dnah7b T C 1: 46,361,495 (GRCm39) F3465S probably damaging Het
Dnmt3a A T 12: 3,923,342 (GRCm39) M181L possibly damaging Het
Duox1 T A 2: 122,163,910 (GRCm39) M859K probably damaging Het
Eif2b4 A T 5: 31,350,284 (GRCm39) S13T probably benign Het
Ercc6 T C 14: 32,298,956 (GRCm39) V1448A probably benign Het
Esp24 A G 17: 39,350,893 (GRCm39) E31G possibly damaging Het
F2rl2 T A 13: 95,837,969 (GRCm39) M338K probably benign Het
Fbxl9 A T 8: 106,039,824 (GRCm39) V517E probably damaging Het
Fgfbp1 A C 5: 44,137,265 (GRCm39) L9R possibly damaging Het
Gal3st2b A T 1: 93,868,338 (GRCm39) N188Y probably damaging Het
Gpr179 G C 11: 97,237,404 (GRCm39) C372W probably damaging Het
Grn T G 11: 102,324,093 (GRCm39) C61G probably damaging Het
Herc1 T G 9: 66,376,292 (GRCm39) C3371G probably damaging Het
Herc1 T C 9: 66,409,366 (GRCm39) probably null Het
Hmcn1 C T 1: 150,462,219 (GRCm39) G5153D possibly damaging Het
Ifi35 A T 11: 101,347,461 (GRCm39) R31W probably damaging Het
Ifit1bl1 T A 19: 34,571,260 (GRCm39) H399L probably benign Het
Irx3 G A 8: 92,527,362 (GRCm39) P114L probably damaging Het
Kat6a T A 8: 23,425,813 (GRCm39) D1119E probably benign Het
Kmt2d G T 15: 98,741,363 (GRCm39) probably benign Het
Kng1 A T 16: 22,897,869 (GRCm39) H423L possibly damaging Het
Lrp2 T A 2: 69,326,833 (GRCm39) Q1746L possibly damaging Het
Lrrc63 A T 14: 75,323,784 (GRCm39) probably null Het
Mad2l1 T A 6: 66,516,797 (GRCm39) V163E possibly damaging Het
Map3k19 A G 1: 127,750,417 (GRCm39) M978T probably benign Het
Mon1a A C 9: 107,778,562 (GRCm39) N262T probably damaging Het
Mpo A G 11: 87,686,707 (GRCm39) N85D probably benign Het
Mpp4 T C 1: 59,183,969 (GRCm39) D244G probably null Het
Mstn A G 1: 53,105,717 (GRCm39) Y353C probably damaging Het
Mx1 T A 16: 97,255,358 (GRCm39) N232Y probably damaging Het
Mycs T C X: 5,380,157 (GRCm39) R308G probably benign Het
Myh11 A T 16: 14,095,734 (GRCm39) D9E probably benign Het
Nfe2l3 A T 6: 51,410,392 (GRCm39) Q169L probably null Het
Nr5a1 G T 2: 38,598,431 (GRCm39) T122N possibly damaging Het
Nras A G 3: 102,966,295 (GRCm39) T20A probably damaging Het
Obp2b T A 2: 25,628,652 (GRCm39) probably null Het
Or1l4 A G 2: 37,091,439 (GRCm39) Y62C probably damaging Het
Or5aq6 T C 2: 86,923,571 (GRCm39) T57A probably damaging Het
Or5w18 T A 2: 87,633,106 (GRCm39) F124L probably benign Het
Or9s14 G A 1: 92,536,122 (GRCm39) V188M probably benign Het
Pcdh17 A T 14: 84,715,094 (GRCm39) T920S probably benign Het
Pcdh9 T C 14: 94,124,661 (GRCm39) D503G probably benign Het
Pcdhb12 C T 18: 37,569,724 (GRCm39) T290I probably damaging Het
Pde6b C A 5: 108,536,557 (GRCm39) C84* probably null Het
Pex1 A T 5: 3,680,044 (GRCm39) N914I probably damaging Het
Pign A G 1: 105,517,042 (GRCm39) V528A possibly damaging Het
Pkhd1 T G 1: 20,604,129 (GRCm39) D1187A possibly damaging Het
Ppip5k1 T C 2: 121,173,112 (GRCm39) K489E probably damaging Het
Prob1 T C 18: 35,786,305 (GRCm39) T650A possibly damaging Het
Radil T C 5: 142,481,091 (GRCm39) Y572C probably damaging Het
Rapgef2 A G 3: 78,996,098 (GRCm39) I555T possibly damaging Het
Rgs5 G A 1: 169,510,386 (GRCm39) probably null Het
Rnaset2b G A 17: 7,248,506 (GRCm39) probably null Het
S1pr1 A G 3: 115,505,587 (GRCm39) S336P probably benign Het
Slc24a5 A G 2: 124,925,115 (GRCm39) E252G possibly damaging Het
Slc34a2 A T 5: 53,218,733 (GRCm39) I184F probably benign Het
Slc35a3 A G 3: 116,471,597 (GRCm39) V224A possibly damaging Het
Slc39a9 A G 12: 80,723,976 (GRCm39) H211R probably damaging Het
Slu7 A G 11: 43,330,095 (GRCm39) N174S probably benign Het
Smarcd3 A T 5: 24,800,820 (GRCm39) Y131* probably null Het
Syne1 A G 10: 5,317,621 (GRCm39) M491T probably benign Het
Tars1 G A 15: 11,394,329 (GRCm39) Q103* probably null Het
Tmem132d C A 5: 127,866,919 (GRCm39) E660D probably benign Het
Ttn T C 2: 76,643,316 (GRCm39) E13201G probably damaging Het
Ttn T A 2: 76,582,605 (GRCm39) M22763L probably benign Het
Ttn T C 2: 76,575,387 (GRCm39) T16842A probably damaging Het
Ubp1 A T 9: 113,785,037 (GRCm39) I117L possibly damaging Het
Usp24 T A 4: 106,234,756 (GRCm39) H954Q probably benign Het
Vmn1r174 G A 7: 23,453,622 (GRCm39) R96H probably benign Het
Vmn2r63 G A 7: 42,577,669 (GRCm39) Q290* probably null Het
Vnn3 T C 10: 23,741,718 (GRCm39) I341T probably benign Het
Wbp2nl A G 15: 82,189,945 (GRCm39) T46A probably damaging Het
Wdr48 G T 9: 119,753,313 (GRCm39) E625* probably null Het
Wdr6 C T 9: 108,452,363 (GRCm39) V507I probably damaging Het
Zp2 A T 7: 119,737,328 (GRCm39) W287R probably benign Het
Other mutations in Or51g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02246:Or51g2 APN 7 102,622,951 (GRCm39) missense possibly damaging 0.62
IGL03111:Or51g2 APN 7 102,622,738 (GRCm39) missense probably damaging 1.00
R1529:Or51g2 UTSW 7 102,623,086 (GRCm39) missense probably damaging 1.00
R3005:Or51g2 UTSW 7 102,622,465 (GRCm39) missense possibly damaging 0.56
R4457:Or51g2 UTSW 7 102,622,734 (GRCm39) missense probably damaging 1.00
R4675:Or51g2 UTSW 7 102,623,013 (GRCm39) missense probably damaging 0.99
R4808:Or51g2 UTSW 7 102,623,118 (GRCm39) missense probably damaging 0.99
R4891:Or51g2 UTSW 7 102,622,759 (GRCm39) missense probably benign 0.12
R4917:Or51g2 UTSW 7 102,622,614 (GRCm39) missense possibly damaging 0.93
R4918:Or51g2 UTSW 7 102,622,614 (GRCm39) missense possibly damaging 0.93
R5328:Or51g2 UTSW 7 102,623,175 (GRCm39) missense possibly damaging 0.46
R6375:Or51g2 UTSW 7 102,622,960 (GRCm39) missense probably damaging 1.00
R6683:Or51g2 UTSW 7 102,622,920 (GRCm39) missense probably benign 0.05
R6958:Or51g2 UTSW 7 102,623,091 (GRCm39) missense possibly damaging 0.67
R7022:Or51g2 UTSW 7 102,623,175 (GRCm39) missense possibly damaging 0.46
R7429:Or51g2 UTSW 7 102,622,969 (GRCm39) missense probably damaging 1.00
R7430:Or51g2 UTSW 7 102,622,969 (GRCm39) missense probably damaging 1.00
R7490:Or51g2 UTSW 7 102,623,017 (GRCm39) missense probably damaging 1.00
R7808:Or51g2 UTSW 7 102,622,317 (GRCm39) missense possibly damaging 0.56
R8169:Or51g2 UTSW 7 102,622,545 (GRCm39) missense probably damaging 0.99
R8544:Or51g2 UTSW 7 102,622,938 (GRCm39) missense probably damaging 1.00
R9027:Or51g2 UTSW 7 102,622,560 (GRCm39) missense probably damaging 1.00
R9265:Or51g2 UTSW 7 102,623,112 (GRCm39) nonsense probably null
X0027:Or51g2 UTSW 7 102,622,893 (GRCm39) missense probably benign 0.05
Z1176:Or51g2 UTSW 7 102,622,516 (GRCm39) missense not run
Z1177:Or51g2 UTSW 7 102,622,516 (GRCm39) missense not run
Predicted Primers PCR Primer
(F):5'- AATCTTCAATGGCCCAGCTCTCAC -3'
(R):5'- TCTGTAATCCACCGCTTTGGGAAAC -3'

Sequencing Primer
(F):5'- aaggctgcgataatctgaattac -3'
(R):5'- ACAGGCCCCCCATCTAGTTC -3'
Posted On 2014-05-23