Incidental Mutation 'R1753:Celsr3'
ID 193758
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Name cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms Fmi1, flamingo, Adgrc3
MMRRC Submission 039785-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1753 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 108703519-108730168 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 108709056 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1301 (V1301F)
Ref Sequence ENSEMBL: ENSMUSP00000024238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192235] [ENSMUST00000213524]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000024238
AA Change: V1301F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: V1301F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192235
AA Change: V40F

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141429
Gene: ENSMUSG00000023473
AA Change: V40F

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
EGF 108 163 4.9e-5 SMART
EGF 168 201 2.6e-6 SMART
EGF_like 208 239 1.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193726
Predicted Effect probably damaging
Transcript: ENSMUST00000213524
AA Change: V1301F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,864,542 (GRCm39) F409I probably benign Het
Adamts19 A C 18: 59,140,444 (GRCm39) I848L possibly damaging Het
Adamts5 T C 16: 85,696,240 (GRCm39) S306G probably damaging Het
Adamts8 T G 9: 30,865,910 (GRCm39) I486S probably benign Het
Adgrg5 T C 8: 95,668,680 (GRCm39) F499L possibly damaging Het
Akr1c21 T A 13: 4,627,134 (GRCm39) C145* probably null Het
Anp32b T G 4: 46,460,241 (GRCm39) probably null Het
Arhgap31 A G 16: 38,421,974 (GRCm39) V1364A possibly damaging Het
C2cd6 T C 1: 59,133,992 (GRCm39) R10G possibly damaging Het
Cacna2d1 A G 5: 16,507,352 (GRCm39) E367G possibly damaging Het
Ccdc81 C T 7: 89,515,769 (GRCm39) E637K probably benign Het
Cd2 A T 3: 101,194,815 (GRCm39) M91K possibly damaging Het
Cdc16 C A 8: 13,814,688 (GRCm39) Y157* probably null Het
Cep164 C T 9: 45,704,235 (GRCm39) G961S probably damaging Het
Cep290 T C 10: 100,349,843 (GRCm39) V630A probably benign Het
Chd5 C T 4: 152,463,272 (GRCm39) S1451F probably damaging Het
Cldn23 A C 8: 36,293,140 (GRCm39) L116R possibly damaging Het
Cngb1 A T 8: 96,024,401 (GRCm39) probably benign Het
Cpb1 G T 3: 20,320,405 (GRCm39) N151K possibly damaging Het
Cpn2 A G 16: 30,078,918 (GRCm39) F261S probably damaging Het
Crlf3 A C 11: 79,948,698 (GRCm39) V249G probably damaging Het
Csmd1 A T 8: 16,207,134 (GRCm39) Y1298* probably null Het
Cstf2t C A 19: 31,061,085 (GRCm39) P207Q possibly damaging Het
Cym A C 3: 107,120,741 (GRCm39) L288R possibly damaging Het
Cyp2j12 C T 4: 96,009,669 (GRCm39) probably null Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dnah7b T C 1: 46,361,495 (GRCm39) F3465S probably damaging Het
Dnmt3a A T 12: 3,923,342 (GRCm39) M181L possibly damaging Het
Duox1 T A 2: 122,163,910 (GRCm39) M859K probably damaging Het
Eif2b4 A T 5: 31,350,284 (GRCm39) S13T probably benign Het
Ercc6 T C 14: 32,298,956 (GRCm39) V1448A probably benign Het
Esp24 A G 17: 39,350,893 (GRCm39) E31G possibly damaging Het
F2rl2 T A 13: 95,837,969 (GRCm39) M338K probably benign Het
Fbxl9 A T 8: 106,039,824 (GRCm39) V517E probably damaging Het
Fgfbp1 A C 5: 44,137,265 (GRCm39) L9R possibly damaging Het
Gal3st2b A T 1: 93,868,338 (GRCm39) N188Y probably damaging Het
Gpr179 G C 11: 97,237,404 (GRCm39) C372W probably damaging Het
Grn T G 11: 102,324,093 (GRCm39) C61G probably damaging Het
Herc1 T G 9: 66,376,292 (GRCm39) C3371G probably damaging Het
Herc1 T C 9: 66,409,366 (GRCm39) probably null Het
Hmcn1 C T 1: 150,462,219 (GRCm39) G5153D possibly damaging Het
Ifi35 A T 11: 101,347,461 (GRCm39) R31W probably damaging Het
Ifit1bl1 T A 19: 34,571,260 (GRCm39) H399L probably benign Het
Irx3 G A 8: 92,527,362 (GRCm39) P114L probably damaging Het
Kat6a T A 8: 23,425,813 (GRCm39) D1119E probably benign Het
Kmt2d G T 15: 98,741,363 (GRCm39) probably benign Het
Kng1 A T 16: 22,897,869 (GRCm39) H423L possibly damaging Het
Lrp2 T A 2: 69,326,833 (GRCm39) Q1746L possibly damaging Het
Lrrc63 A T 14: 75,323,784 (GRCm39) probably null Het
Mad2l1 T A 6: 66,516,797 (GRCm39) V163E possibly damaging Het
Map3k19 A G 1: 127,750,417 (GRCm39) M978T probably benign Het
Mon1a A C 9: 107,778,562 (GRCm39) N262T probably damaging Het
Mpo A G 11: 87,686,707 (GRCm39) N85D probably benign Het
Mpp4 T C 1: 59,183,969 (GRCm39) D244G probably null Het
Mstn A G 1: 53,105,717 (GRCm39) Y353C probably damaging Het
Mx1 T A 16: 97,255,358 (GRCm39) N232Y probably damaging Het
Mycs T C X: 5,380,157 (GRCm39) R308G probably benign Het
Myh11 A T 16: 14,095,734 (GRCm39) D9E probably benign Het
Nfe2l3 A T 6: 51,410,392 (GRCm39) Q169L probably null Het
Nr5a1 G T 2: 38,598,431 (GRCm39) T122N possibly damaging Het
Nras A G 3: 102,966,295 (GRCm39) T20A probably damaging Het
Obp2b T A 2: 25,628,652 (GRCm39) probably null Het
Or1l4 A G 2: 37,091,439 (GRCm39) Y62C probably damaging Het
Or51g2 T C 7: 102,622,263 (GRCm39) N312S probably benign Het
Or5aq6 T C 2: 86,923,571 (GRCm39) T57A probably damaging Het
Or5w18 T A 2: 87,633,106 (GRCm39) F124L probably benign Het
Or9s14 G A 1: 92,536,122 (GRCm39) V188M probably benign Het
Pcdh17 A T 14: 84,715,094 (GRCm39) T920S probably benign Het
Pcdh9 T C 14: 94,124,661 (GRCm39) D503G probably benign Het
Pcdhb12 C T 18: 37,569,724 (GRCm39) T290I probably damaging Het
Pde6b C A 5: 108,536,557 (GRCm39) C84* probably null Het
Pex1 A T 5: 3,680,044 (GRCm39) N914I probably damaging Het
Pign A G 1: 105,517,042 (GRCm39) V528A possibly damaging Het
Pkhd1 T G 1: 20,604,129 (GRCm39) D1187A possibly damaging Het
Ppip5k1 T C 2: 121,173,112 (GRCm39) K489E probably damaging Het
Prob1 T C 18: 35,786,305 (GRCm39) T650A possibly damaging Het
Radil T C 5: 142,481,091 (GRCm39) Y572C probably damaging Het
Rapgef2 A G 3: 78,996,098 (GRCm39) I555T possibly damaging Het
Rgs5 G A 1: 169,510,386 (GRCm39) probably null Het
Rnaset2b G A 17: 7,248,506 (GRCm39) probably null Het
S1pr1 A G 3: 115,505,587 (GRCm39) S336P probably benign Het
Slc24a5 A G 2: 124,925,115 (GRCm39) E252G possibly damaging Het
Slc34a2 A T 5: 53,218,733 (GRCm39) I184F probably benign Het
Slc35a3 A G 3: 116,471,597 (GRCm39) V224A possibly damaging Het
Slc39a9 A G 12: 80,723,976 (GRCm39) H211R probably damaging Het
Slu7 A G 11: 43,330,095 (GRCm39) N174S probably benign Het
Smarcd3 A T 5: 24,800,820 (GRCm39) Y131* probably null Het
Syne1 A G 10: 5,317,621 (GRCm39) M491T probably benign Het
Tars1 G A 15: 11,394,329 (GRCm39) Q103* probably null Het
Tmem132d C A 5: 127,866,919 (GRCm39) E660D probably benign Het
Ttn T C 2: 76,575,387 (GRCm39) T16842A probably damaging Het
Ttn T C 2: 76,643,316 (GRCm39) E13201G probably damaging Het
Ttn T A 2: 76,582,605 (GRCm39) M22763L probably benign Het
Ubp1 A T 9: 113,785,037 (GRCm39) I117L possibly damaging Het
Usp24 T A 4: 106,234,756 (GRCm39) H954Q probably benign Het
Vmn1r174 G A 7: 23,453,622 (GRCm39) R96H probably benign Het
Vmn2r63 G A 7: 42,577,669 (GRCm39) Q290* probably null Het
Vnn3 T C 10: 23,741,718 (GRCm39) I341T probably benign Het
Wbp2nl A G 15: 82,189,945 (GRCm39) T46A probably damaging Het
Wdr48 G T 9: 119,753,313 (GRCm39) E625* probably null Het
Wdr6 C T 9: 108,452,363 (GRCm39) V507I probably damaging Het
Zp2 A T 7: 119,737,328 (GRCm39) W287R probably benign Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108,726,124 (GRCm39) missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108,706,391 (GRCm39) missense probably benign 0.33
IGL00552:Celsr3 APN 9 108,718,462 (GRCm39) missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108,719,775 (GRCm39) missense probably benign
IGL01420:Celsr3 APN 9 108,718,389 (GRCm39) critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108,708,907 (GRCm39) missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108,711,756 (GRCm39) missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108,714,603 (GRCm39) missense probably benign 0.00
IGL01631:Celsr3 APN 9 108,714,603 (GRCm39) missense probably benign 0.00
IGL01777:Celsr3 APN 9 108,713,141 (GRCm39) missense probably benign 0.08
IGL01938:Celsr3 APN 9 108,705,614 (GRCm39) missense probably benign 0.34
IGL02135:Celsr3 APN 9 108,704,755 (GRCm39) missense probably benign 0.11
IGL02231:Celsr3 APN 9 108,719,709 (GRCm39) missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108,707,159 (GRCm39) missense probably benign
IGL02392:Celsr3 APN 9 108,711,920 (GRCm39) splice site probably benign
IGL02416:Celsr3 APN 9 108,709,318 (GRCm39) missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108,717,662 (GRCm39) missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108,720,092 (GRCm39) missense probably benign 0.15
IGL02798:Celsr3 APN 9 108,720,774 (GRCm39) missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108,726,652 (GRCm39) missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108,723,134 (GRCm39) missense probably benign 0.12
IGL02986:Celsr3 APN 9 108,718,454 (GRCm39) splice site probably null
IGL03089:Celsr3 APN 9 108,703,806 (GRCm39) missense probably benign 0.04
IGL03162:Celsr3 APN 9 108,719,757 (GRCm39) missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108,713,724 (GRCm39) splice site probably benign
Diminishment UTSW 9 108,719,907 (GRCm39) intron probably benign
little_d UTSW 9 108,704,891 (GRCm39) missense probably damaging 0.98
nogal UTSW 9 108,713,037 (GRCm39) missense probably benign
F6893:Celsr3 UTSW 9 108,712,266 (GRCm39) missense probably benign 0.00
PIT4243001:Celsr3 UTSW 9 108,709,507 (GRCm39) missense probably benign 0.13
PIT4810001:Celsr3 UTSW 9 108,722,932 (GRCm39) missense probably damaging 1.00
R0110:Celsr3 UTSW 9 108,704,204 (GRCm39) missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108,720,923 (GRCm39) splice site probably benign
R0382:Celsr3 UTSW 9 108,706,417 (GRCm39) missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108,706,272 (GRCm39) nonsense probably null
R0510:Celsr3 UTSW 9 108,704,204 (GRCm39) missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108,704,891 (GRCm39) missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108,711,854 (GRCm39) missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108,705,017 (GRCm39) missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108,719,832 (GRCm39) missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108,723,224 (GRCm39) missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108,710,375 (GRCm39) missense probably benign 0.17
R1321:Celsr3 UTSW 9 108,713,069 (GRCm39) missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108,704,104 (GRCm39) missense probably benign 0.00
R1497:Celsr3 UTSW 9 108,726,064 (GRCm39) missense probably benign 0.14
R1520:Celsr3 UTSW 9 108,725,857 (GRCm39) missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108,726,083 (GRCm39) missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108,706,267 (GRCm39) missense probably damaging 1.00
R1657:Celsr3 UTSW 9 108,720,151 (GRCm39) nonsense probably null
R1764:Celsr3 UTSW 9 108,706,157 (GRCm39) missense probably damaging 1.00
R1801:Celsr3 UTSW 9 108,711,825 (GRCm39) missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108,707,105 (GRCm39) missense probably benign
R1839:Celsr3 UTSW 9 108,707,105 (GRCm39) missense probably benign
R1874:Celsr3 UTSW 9 108,713,037 (GRCm39) missense probably benign
R1875:Celsr3 UTSW 9 108,713,037 (GRCm39) missense probably benign
R1953:Celsr3 UTSW 9 108,720,381 (GRCm39) missense probably benign 0.19
R1960:Celsr3 UTSW 9 108,723,016 (GRCm39) missense probably benign
R2113:Celsr3 UTSW 9 108,715,669 (GRCm39) missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108,720,423 (GRCm39) missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2373:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2374:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2375:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2844:Celsr3 UTSW 9 108,706,507 (GRCm39) missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108,709,390 (GRCm39) missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108,714,338 (GRCm39) missense probably benign 0.31
R3159:Celsr3 UTSW 9 108,704,909 (GRCm39) missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R4194:Celsr3 UTSW 9 108,720,501 (GRCm39) critical splice donor site probably null
R4329:Celsr3 UTSW 9 108,723,248 (GRCm39) missense probably benign 0.00
R4365:Celsr3 UTSW 9 108,707,046 (GRCm39) missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108,720,443 (GRCm39) missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108,723,262 (GRCm39) critical splice donor site probably null
R4582:Celsr3 UTSW 9 108,722,922 (GRCm39) missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108,704,953 (GRCm39) missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108,724,851 (GRCm39) missense probably benign 0.05
R4881:Celsr3 UTSW 9 108,721,140 (GRCm39) missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108,726,620 (GRCm39) missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108,714,759 (GRCm39) missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108,709,958 (GRCm39) missense probably benign 0.01
R5290:Celsr3 UTSW 9 108,720,357 (GRCm39) missense probably benign 0.01
R5327:Celsr3 UTSW 9 108,719,907 (GRCm39) intron probably benign
R5345:Celsr3 UTSW 9 108,709,323 (GRCm39) missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108,709,224 (GRCm39) missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108,705,781 (GRCm39) missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108,717,241 (GRCm39) missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108,721,233 (GRCm39) missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108,705,836 (GRCm39) missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108,721,743 (GRCm39) critical splice donor site probably null
R5629:Celsr3 UTSW 9 108,726,266 (GRCm39) missense probably benign 0.41
R5637:Celsr3 UTSW 9 108,714,332 (GRCm39) missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108,715,671 (GRCm39) missense probably benign 0.03
R5739:Celsr3 UTSW 9 108,704,357 (GRCm39) missense probably benign
R5785:Celsr3 UTSW 9 108,704,996 (GRCm39) missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108,722,926 (GRCm39) missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108,708,993 (GRCm39) missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108,714,350 (GRCm39) missense probably benign 0.01
R6176:Celsr3 UTSW 9 108,705,554 (GRCm39) missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108,706,041 (GRCm39) missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108,712,989 (GRCm39) missense probably benign 0.08
R6481:Celsr3 UTSW 9 108,714,283 (GRCm39) missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108,706,327 (GRCm39) missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108,704,549 (GRCm39) missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108,706,390 (GRCm39) missense probably benign 0.02
R6977:Celsr3 UTSW 9 108,704,914 (GRCm39) missense probably benign
R7061:Celsr3 UTSW 9 108,724,793 (GRCm39) nonsense probably null
R7122:Celsr3 UTSW 9 108,705,766 (GRCm39) missense possibly damaging 0.90
R7156:Celsr3 UTSW 9 108,715,203 (GRCm39) missense possibly damaging 0.95
R7166:Celsr3 UTSW 9 108,720,150 (GRCm39) missense probably damaging 1.00
R7176:Celsr3 UTSW 9 108,722,961 (GRCm39) missense probably benign
R7213:Celsr3 UTSW 9 108,726,239 (GRCm39) missense probably damaging 0.98
R7314:Celsr3 UTSW 9 108,706,343 (GRCm39) missense probably damaging 1.00
R7478:Celsr3 UTSW 9 108,720,777 (GRCm39) missense probably benign 0.37
R7508:Celsr3 UTSW 9 108,713,821 (GRCm39) missense probably benign
R7554:Celsr3 UTSW 9 108,718,408 (GRCm39) missense probably benign
R7615:Celsr3 UTSW 9 108,714,851 (GRCm39) missense possibly damaging 0.75
R7653:Celsr3 UTSW 9 108,712,269 (GRCm39) nonsense probably null
R7747:Celsr3 UTSW 9 108,707,177 (GRCm39) missense possibly damaging 0.61
R7881:Celsr3 UTSW 9 108,705,271 (GRCm39) missense probably benign 0.28
R7935:Celsr3 UTSW 9 108,706,840 (GRCm39) missense probably benign 0.01
R7995:Celsr3 UTSW 9 108,722,282 (GRCm39) missense probably damaging 0.99
R8006:Celsr3 UTSW 9 108,706,306 (GRCm39) missense probably damaging 1.00
R8077:Celsr3 UTSW 9 108,705,530 (GRCm39) missense probably benign 0.15
R8284:Celsr3 UTSW 9 108,723,612 (GRCm39) missense probably damaging 0.99
R8291:Celsr3 UTSW 9 108,715,169 (GRCm39) missense probably damaging 1.00
R8322:Celsr3 UTSW 9 108,725,993 (GRCm39) missense probably damaging 1.00
R8334:Celsr3 UTSW 9 108,718,471 (GRCm39) frame shift probably null
R8337:Celsr3 UTSW 9 108,718,471 (GRCm39) frame shift probably null
R8338:Celsr3 UTSW 9 108,704,539 (GRCm39) nonsense probably null
R8353:Celsr3 UTSW 9 108,703,734 (GRCm39) missense probably benign 0.00
R8407:Celsr3 UTSW 9 108,706,256 (GRCm39) missense probably damaging 1.00
R8408:Celsr3 UTSW 9 108,708,988 (GRCm39) missense probably damaging 1.00
R8459:Celsr3 UTSW 9 108,706,829 (GRCm39) missense probably damaging 1.00
R8510:Celsr3 UTSW 9 108,715,319 (GRCm39) missense possibly damaging 0.93
R8713:Celsr3 UTSW 9 108,707,062 (GRCm39) missense probably benign
R8728:Celsr3 UTSW 9 108,723,940 (GRCm39) missense probably benign 0.24
R8829:Celsr3 UTSW 9 108,717,582 (GRCm39) missense probably benign
R8877:Celsr3 UTSW 9 108,706,877 (GRCm39) missense probably damaging 1.00
R8905:Celsr3 UTSW 9 108,718,501 (GRCm39) missense probably damaging 1.00
R9008:Celsr3 UTSW 9 108,706,151 (GRCm39) missense possibly damaging 0.94
R9072:Celsr3 UTSW 9 108,704,293 (GRCm39) missense probably benign
R9157:Celsr3 UTSW 9 108,707,185 (GRCm39) missense probably damaging 1.00
R9183:Celsr3 UTSW 9 108,706,595 (GRCm39) missense probably damaging 1.00
R9275:Celsr3 UTSW 9 108,715,689 (GRCm39) missense probably benign 0.27
R9361:Celsr3 UTSW 9 108,726,521 (GRCm39) missense probably damaging 1.00
R9382:Celsr3 UTSW 9 108,706,961 (GRCm39) missense possibly damaging 0.60
R9407:Celsr3 UTSW 9 108,723,596 (GRCm39) missense probably damaging 1.00
R9432:Celsr3 UTSW 9 108,726,032 (GRCm39) missense probably benign 0.00
R9607:Celsr3 UTSW 9 108,717,701 (GRCm39) critical splice donor site probably null
R9626:Celsr3 UTSW 9 108,726,521 (GRCm39) missense probably damaging 1.00
R9628:Celsr3 UTSW 9 108,703,559 (GRCm39) nonsense probably null
R9630:Celsr3 UTSW 9 108,704,296 (GRCm39) missense probably benign
R9645:Celsr3 UTSW 9 108,704,691 (GRCm39) nonsense probably null
R9683:Celsr3 UTSW 9 108,704,522 (GRCm39) missense probably damaging 1.00
R9794:Celsr3 UTSW 9 108,728,502 (GRCm39) missense probably benign 0.00
R9798:Celsr3 UTSW 9 108,705,794 (GRCm39) missense probably damaging 1.00
RF020:Celsr3 UTSW 9 108,726,256 (GRCm39) missense probably benign
X0018:Celsr3 UTSW 9 108,717,611 (GRCm39) missense probably benign 0.01
X0018:Celsr3 UTSW 9 108,704,977 (GRCm39) missense possibly damaging 0.65
X0026:Celsr3 UTSW 9 108,706,129 (GRCm39) missense probably damaging 0.99
Z1177:Celsr3 UTSW 9 108,703,676 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGACCCGAAACTGATCACTGTCCC -3'
(R):5'- CAGGCACACGTTGTCGTCAAAG -3'

Sequencing Primer
(F):5'- CAGATGGCCTGCATAGTGTTAC -3'
(R):5'- TTGTCGTCAAAGGGCAGC -3'
Posted On 2014-05-23