Incidental Mutation 'R1753:Tars1'
ID 193782
Institutional Source Beutler Lab
Gene Symbol Tars1
Ensembl Gene ENSMUSG00000022241
Gene Name threonyl-tRNA synthetase 1
Synonyms D15Wsu59e, Tars, ThrRS
MMRRC Submission 039785-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R1753 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 11383749-11399744 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 11394329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 103 (Q103*)
Ref Sequence ENSEMBL: ENSMUSP00000153826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022849] [ENSMUST00000228814]
AlphaFold Q9D0R2
Predicted Effect probably null
Transcript: ENSMUST00000022849
AA Change: Q103*
SMART Domains Protein: ENSMUSP00000022849
Gene: ENSMUSG00000022241
AA Change: Q103*

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Pfam:TGS 82 142 7.5e-18 PFAM
tRNA_SAD 248 297 1.91e-16 SMART
Pfam:tRNA-synt_2b 396 607 5e-38 PFAM
Pfam:HGTP_anticodon 619 710 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228207
Predicted Effect probably null
Transcript: ENSMUST00000228814
AA Change: Q103*
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Threonyl-tRNA synthetase belongs to the class-II aminoacyl-tRNA synthetase family [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,864,542 (GRCm39) F409I probably benign Het
Adamts19 A C 18: 59,140,444 (GRCm39) I848L possibly damaging Het
Adamts5 T C 16: 85,696,240 (GRCm39) S306G probably damaging Het
Adamts8 T G 9: 30,865,910 (GRCm39) I486S probably benign Het
Adgrg5 T C 8: 95,668,680 (GRCm39) F499L possibly damaging Het
Akr1c21 T A 13: 4,627,134 (GRCm39) C145* probably null Het
Anp32b T G 4: 46,460,241 (GRCm39) probably null Het
Arhgap31 A G 16: 38,421,974 (GRCm39) V1364A possibly damaging Het
C2cd6 T C 1: 59,133,992 (GRCm39) R10G possibly damaging Het
Cacna2d1 A G 5: 16,507,352 (GRCm39) E367G possibly damaging Het
Ccdc81 C T 7: 89,515,769 (GRCm39) E637K probably benign Het
Cd2 A T 3: 101,194,815 (GRCm39) M91K possibly damaging Het
Cdc16 C A 8: 13,814,688 (GRCm39) Y157* probably null Het
Celsr3 G T 9: 108,709,056 (GRCm39) V1301F probably damaging Het
Cep164 C T 9: 45,704,235 (GRCm39) G961S probably damaging Het
Cep290 T C 10: 100,349,843 (GRCm39) V630A probably benign Het
Chd5 C T 4: 152,463,272 (GRCm39) S1451F probably damaging Het
Cldn23 A C 8: 36,293,140 (GRCm39) L116R possibly damaging Het
Cngb1 A T 8: 96,024,401 (GRCm39) probably benign Het
Cpb1 G T 3: 20,320,405 (GRCm39) N151K possibly damaging Het
Cpn2 A G 16: 30,078,918 (GRCm39) F261S probably damaging Het
Crlf3 A C 11: 79,948,698 (GRCm39) V249G probably damaging Het
Csmd1 A T 8: 16,207,134 (GRCm39) Y1298* probably null Het
Cstf2t C A 19: 31,061,085 (GRCm39) P207Q possibly damaging Het
Cym A C 3: 107,120,741 (GRCm39) L288R possibly damaging Het
Cyp2j12 C T 4: 96,009,669 (GRCm39) probably null Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dnah7b T C 1: 46,361,495 (GRCm39) F3465S probably damaging Het
Dnmt3a A T 12: 3,923,342 (GRCm39) M181L possibly damaging Het
Duox1 T A 2: 122,163,910 (GRCm39) M859K probably damaging Het
Eif2b4 A T 5: 31,350,284 (GRCm39) S13T probably benign Het
Ercc6 T C 14: 32,298,956 (GRCm39) V1448A probably benign Het
Esp24 A G 17: 39,350,893 (GRCm39) E31G possibly damaging Het
F2rl2 T A 13: 95,837,969 (GRCm39) M338K probably benign Het
Fbxl9 A T 8: 106,039,824 (GRCm39) V517E probably damaging Het
Fgfbp1 A C 5: 44,137,265 (GRCm39) L9R possibly damaging Het
Gal3st2b A T 1: 93,868,338 (GRCm39) N188Y probably damaging Het
Gpr179 G C 11: 97,237,404 (GRCm39) C372W probably damaging Het
Grn T G 11: 102,324,093 (GRCm39) C61G probably damaging Het
Herc1 T G 9: 66,376,292 (GRCm39) C3371G probably damaging Het
Herc1 T C 9: 66,409,366 (GRCm39) probably null Het
Hmcn1 C T 1: 150,462,219 (GRCm39) G5153D possibly damaging Het
Ifi35 A T 11: 101,347,461 (GRCm39) R31W probably damaging Het
Ifit1bl1 T A 19: 34,571,260 (GRCm39) H399L probably benign Het
Irx3 G A 8: 92,527,362 (GRCm39) P114L probably damaging Het
Kat6a T A 8: 23,425,813 (GRCm39) D1119E probably benign Het
Kmt2d G T 15: 98,741,363 (GRCm39) probably benign Het
Kng1 A T 16: 22,897,869 (GRCm39) H423L possibly damaging Het
Lrp2 T A 2: 69,326,833 (GRCm39) Q1746L possibly damaging Het
Lrrc63 A T 14: 75,323,784 (GRCm39) probably null Het
Mad2l1 T A 6: 66,516,797 (GRCm39) V163E possibly damaging Het
Map3k19 A G 1: 127,750,417 (GRCm39) M978T probably benign Het
Mon1a A C 9: 107,778,562 (GRCm39) N262T probably damaging Het
Mpo A G 11: 87,686,707 (GRCm39) N85D probably benign Het
Mpp4 T C 1: 59,183,969 (GRCm39) D244G probably null Het
Mstn A G 1: 53,105,717 (GRCm39) Y353C probably damaging Het
Mx1 T A 16: 97,255,358 (GRCm39) N232Y probably damaging Het
Mycs T C X: 5,380,157 (GRCm39) R308G probably benign Het
Myh11 A T 16: 14,095,734 (GRCm39) D9E probably benign Het
Nfe2l3 A T 6: 51,410,392 (GRCm39) Q169L probably null Het
Nr5a1 G T 2: 38,598,431 (GRCm39) T122N possibly damaging Het
Nras A G 3: 102,966,295 (GRCm39) T20A probably damaging Het
Obp2b T A 2: 25,628,652 (GRCm39) probably null Het
Or1l4 A G 2: 37,091,439 (GRCm39) Y62C probably damaging Het
Or51g2 T C 7: 102,622,263 (GRCm39) N312S probably benign Het
Or5aq6 T C 2: 86,923,571 (GRCm39) T57A probably damaging Het
Or5w18 T A 2: 87,633,106 (GRCm39) F124L probably benign Het
Or9s14 G A 1: 92,536,122 (GRCm39) V188M probably benign Het
Pcdh17 A T 14: 84,715,094 (GRCm39) T920S probably benign Het
Pcdh9 T C 14: 94,124,661 (GRCm39) D503G probably benign Het
Pcdhb12 C T 18: 37,569,724 (GRCm39) T290I probably damaging Het
Pde6b C A 5: 108,536,557 (GRCm39) C84* probably null Het
Pex1 A T 5: 3,680,044 (GRCm39) N914I probably damaging Het
Pign A G 1: 105,517,042 (GRCm39) V528A possibly damaging Het
Pkhd1 T G 1: 20,604,129 (GRCm39) D1187A possibly damaging Het
Ppip5k1 T C 2: 121,173,112 (GRCm39) K489E probably damaging Het
Prob1 T C 18: 35,786,305 (GRCm39) T650A possibly damaging Het
Radil T C 5: 142,481,091 (GRCm39) Y572C probably damaging Het
Rapgef2 A G 3: 78,996,098 (GRCm39) I555T possibly damaging Het
Rgs5 G A 1: 169,510,386 (GRCm39) probably null Het
Rnaset2b G A 17: 7,248,506 (GRCm39) probably null Het
S1pr1 A G 3: 115,505,587 (GRCm39) S336P probably benign Het
Slc24a5 A G 2: 124,925,115 (GRCm39) E252G possibly damaging Het
Slc34a2 A T 5: 53,218,733 (GRCm39) I184F probably benign Het
Slc35a3 A G 3: 116,471,597 (GRCm39) V224A possibly damaging Het
Slc39a9 A G 12: 80,723,976 (GRCm39) H211R probably damaging Het
Slu7 A G 11: 43,330,095 (GRCm39) N174S probably benign Het
Smarcd3 A T 5: 24,800,820 (GRCm39) Y131* probably null Het
Syne1 A G 10: 5,317,621 (GRCm39) M491T probably benign Het
Tmem132d C A 5: 127,866,919 (GRCm39) E660D probably benign Het
Ttn T C 2: 76,575,387 (GRCm39) T16842A probably damaging Het
Ttn T C 2: 76,643,316 (GRCm39) E13201G probably damaging Het
Ttn T A 2: 76,582,605 (GRCm39) M22763L probably benign Het
Ubp1 A T 9: 113,785,037 (GRCm39) I117L possibly damaging Het
Usp24 T A 4: 106,234,756 (GRCm39) H954Q probably benign Het
Vmn1r174 G A 7: 23,453,622 (GRCm39) R96H probably benign Het
Vmn2r63 G A 7: 42,577,669 (GRCm39) Q290* probably null Het
Vnn3 T C 10: 23,741,718 (GRCm39) I341T probably benign Het
Wbp2nl A G 15: 82,189,945 (GRCm39) T46A probably damaging Het
Wdr48 G T 9: 119,753,313 (GRCm39) E625* probably null Het
Wdr6 C T 9: 108,452,363 (GRCm39) V507I probably damaging Het
Zp2 A T 7: 119,737,328 (GRCm39) W287R probably benign Het
Other mutations in Tars1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Tars1 APN 15 11,388,307 (GRCm39) splice site probably null
IGL00642:Tars1 APN 15 11,394,458 (GRCm39) missense probably damaging 1.00
IGL01315:Tars1 APN 15 11,389,820 (GRCm39) nonsense probably null
IGL01459:Tars1 APN 15 11,391,940 (GRCm39) missense possibly damaging 0.76
IGL02141:Tars1 APN 15 11,391,280 (GRCm39) missense probably damaging 0.96
IGL03292:Tars1 APN 15 11,384,107 (GRCm39) missense probably benign 0.22
R0383:Tars1 UTSW 15 11,390,411 (GRCm39) missense probably benign
R0517:Tars1 UTSW 15 11,394,452 (GRCm39) nonsense probably null
R0685:Tars1 UTSW 15 11,385,259 (GRCm39) missense probably benign
R1589:Tars1 UTSW 15 11,388,261 (GRCm39) missense probably benign 0.32
R2051:Tars1 UTSW 15 11,393,280 (GRCm39) nonsense probably null
R2060:Tars1 UTSW 15 11,394,459 (GRCm39) missense probably benign 0.03
R2216:Tars1 UTSW 15 11,389,794 (GRCm39) missense probably benign 0.00
R3610:Tars1 UTSW 15 11,392,990 (GRCm39) missense probably damaging 0.99
R4656:Tars1 UTSW 15 11,394,350 (GRCm39) missense probably damaging 1.00
R4844:Tars1 UTSW 15 11,385,281 (GRCm39) missense possibly damaging 0.85
R4974:Tars1 UTSW 15 11,390,477 (GRCm39) missense probably damaging 1.00
R5551:Tars1 UTSW 15 11,392,068 (GRCm39) missense probably damaging 0.97
R5992:Tars1 UTSW 15 11,397,282 (GRCm39) missense probably damaging 1.00
R6742:Tars1 UTSW 15 11,394,427 (GRCm39) missense probably damaging 0.98
R6778:Tars1 UTSW 15 11,389,785 (GRCm39) missense probably benign 0.06
R6850:Tars1 UTSW 15 11,392,885 (GRCm39) missense probably benign
R7270:Tars1 UTSW 15 11,392,105 (GRCm39) missense probably benign 0.00
R7401:Tars1 UTSW 15 11,392,095 (GRCm39) nonsense probably null
R7743:Tars1 UTSW 15 11,399,458 (GRCm39) splice site probably null
R8062:Tars1 UTSW 15 11,388,400 (GRCm39) missense possibly damaging 0.78
R8852:Tars1 UTSW 15 11,393,348 (GRCm39) missense probably benign 0.02
R8942:Tars1 UTSW 15 11,384,183 (GRCm39) missense probably benign 0.27
R9205:Tars1 UTSW 15 11,397,265 (GRCm39) critical splice donor site probably null
R9362:Tars1 UTSW 15 11,387,616 (GRCm39) missense probably damaging 1.00
R9668:Tars1 UTSW 15 11,394,446 (GRCm39) nonsense probably null
Z1088:Tars1 UTSW 15 11,391,970 (GRCm39) missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CCTCCTAAGAGAAAAGCGAGGTGTG -3'
(R):5'- TGCCAGTGACCATTGTGATCTGTG -3'

Sequencing Primer
(F):5'- GTGAGTCCTGACCACAAAGTTC -3'
(R):5'- CCATTGTGATCTGTGAAGCAATCTG -3'
Posted On 2014-05-23