Mutagenetix > Incidental Mutation

Incidental Mutation 'R1753:Myh11'

193785

Institutional Source

Beutler Lab

Gene Symbol

Myh11

Ensembl Gene

ENSMUSG00000018830

Gene Name

myosin, heavy polypeptide 11, smooth muscle

Synonyms

smMHC, SM1, SM2

MMRRC Submission

039785-MU

Accession Numbers

Genbank: NM_013607, NM_001161775

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1753 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14194535-14291372 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 14277870 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 9 (D9E)

Ref Sequence

ENSEMBL: ENSMUSP00000156021 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090287
AA Change: D9E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830
AA Change: D9E

Domain	Start	End	E-Value	Type
Pfam:Myosin_N	33	73	1e-15	PFAM
MYSc	79	784	N/A	SMART
IQ	785	807	1.09e-2	SMART
Pfam:Myosin_tail_1	848	1928	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000230397
AA Change: D9E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230643

Predicted Effect

probably benign
Transcript: ENSMUST00000231567
AA Change: D9E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	T	11: 109,973,716	F409I	probably benign	Het
Adamts19	A	C	18: 59,007,372	I848L	possibly damaging	Het
Adamts5	T	C	16: 85,899,352	S306G	probably damaging	Het
Adamts8	T	G	9: 30,954,614	I486S	probably benign	Het
Adgrg5	T	C	8: 94,942,052	F499L	possibly damaging	Het
Akr1c21	T	A	13: 4,577,135	C145*	probably null	Het
Anp32b	T	G	4: 46,460,241		probably null	Het
Arhgap31	A	G	16: 38,601,612	V1364A	possibly damaging	Het
C2cd6	T	C	1: 59,094,833	R10G	possibly damaging	Het
Cacna2d1	A	G	5: 16,302,354	E367G	possibly damaging	Het
Ccdc81	C	T	7: 89,866,561	E637K	probably benign	Het
Cd2	A	T	3: 101,287,499	M91K	possibly damaging	Het
Cdc16	C	A	8: 13,764,688	Y157*	probably null	Het
Celsr3	G	T	9: 108,831,857	V1301F	probably damaging	Het
Cep164	C	T	9: 45,792,937	G961S	probably damaging	Het
Cep290	T	C	10: 100,513,981	V630A	probably benign	Het
Chd5	C	T	4: 152,378,815	S1451F	probably damaging	Het
Cldn23	A	C	8: 35,825,986	L116R	possibly damaging	Het
Cngb1	A	T	8: 95,297,773		probably benign	Het
Cpb1	G	T	3: 20,266,241	N151K	possibly damaging	Het
Cpn2	A	G	16: 30,260,100	F261S	probably damaging	Het
Crlf3	A	C	11: 80,057,872	V249G	probably damaging	Het
Csmd1	A	T	8: 16,157,120	Y1298*	probably null	Het
Cstf2t	C	A	19: 31,083,685	P207Q	possibly damaging	Het
Cym	A	C	3: 107,213,425	L288R	possibly damaging	Het
Cyp2j12	C	T	4: 96,121,432		probably null	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Dnah7b	T	C	1: 46,322,335	F3465S	probably damaging	Het
Dnmt3a	A	T	12: 3,873,342	M181L	possibly damaging	Het
Duox1	T	A	2: 122,333,429	M859K	probably damaging	Het
Eif2b4	A	T	5: 31,192,940	S13T	probably benign	Het
Ercc6	T	C	14: 32,576,999	V1448A	probably benign	Het
Esp24	A	G	17: 39,040,002	E31G	possibly damaging	Het
F2rl2	T	A	13: 95,701,461	M338K	probably benign	Het
Fgfbp1	A	C	5: 43,979,923	L9R	possibly damaging	Het
Gal3st2b	A	T	1: 93,940,616	N188Y	probably damaging	Het
Gpr179	G	C	11: 97,346,578	C372W	probably damaging	Het
Grn	T	G	11: 102,433,267	C61G	probably damaging	Het
Herc1	T	G	9: 66,469,010	C3371G	probably damaging	Het
Herc1	T	C	9: 66,502,084		probably null	Het
Hmcn1	C	T	1: 150,586,468	G5153D	possibly damaging	Het
Ifi35	A	T	11: 101,456,635	R31W	probably damaging	Het
Ifit1bl1	T	A	19: 34,593,860	H399L	probably benign	Het
Irx3	G	A	8: 91,800,734	P114L	probably damaging	Het
Kat6a	T	A	8: 22,935,797	D1119E	probably benign	Het
Kmt2d	G	T	15: 98,843,482		probably benign	Het
Kng1	A	T	16: 23,079,119	H423L	possibly damaging	Het
Lrp2	T	A	2: 69,496,489	Q1746L	possibly damaging	Het
Lrrc29	A	T	8: 105,313,192	V517E	probably damaging	Het
Lrrc63	A	T	14: 75,086,344		probably null	Het
Mad2l1	T	A	6: 66,539,813	V163E	possibly damaging	Het
Map3k19	A	G	1: 127,822,680	M978T	probably benign	Het
Mon1a	A	C	9: 107,901,363	N262T	probably damaging	Het
Mpo	A	G	11: 87,795,881	N85D	probably benign	Het
Mpp4	T	C	1: 59,144,810	D244G	probably null	Het
Mstn	A	G	1: 53,066,558	Y353C	probably damaging	Het
Mx1	T	A	16: 97,454,158	N232Y	probably damaging	Het
Mycs	T	C	X: 5,468,103	R308G	probably benign	Het
Nfe2l3	A	T	6: 51,433,412	Q169L	probably null	Het
Nr5a1	G	T	2: 38,708,419	T122N	possibly damaging	Het
Nras	A	G	3: 103,058,979	T20A	probably damaging	Het
Obp2b	T	A	2: 25,738,640		probably null	Het
Olfr1109	T	C	2: 87,093,227	T57A	probably damaging	Het
Olfr1143	T	A	2: 87,802,762	F124L	probably benign	Het
Olfr1410	G	A	1: 92,608,400	V188M	probably benign	Het
Olfr365	A	G	2: 37,201,427	Y62C	probably damaging	Het
Olfr577	T	C	7: 102,973,056	N312S	probably benign	Het
Pcdh17	A	T	14: 84,477,654	T920S	probably benign	Het
Pcdh9	T	C	14: 93,887,225	D503G	probably benign	Het
Pcdhb12	C	T	18: 37,436,671	T290I	probably damaging	Het
Pde6b	C	A	5: 108,388,691	C84*	probably null	Het
Pex1	A	T	5: 3,630,044	N914I	probably damaging	Het
Pign	A	G	1: 105,589,317	V528A	possibly damaging	Het
Pkhd1	T	G	1: 20,533,905	D1187A	possibly damaging	Het
Ppip5k1	T	C	2: 121,342,631	K489E	probably damaging	Het
Prob1	T	C	18: 35,653,252	T650A	possibly damaging	Het
Radil	T	C	5: 142,495,336	Y572C	probably damaging	Het
Rapgef2	A	G	3: 79,088,791	I555T	possibly damaging	Het
Rgs5	G	A	1: 169,682,817		probably null	Het
Rnaset2b	G	A	17: 6,981,107		probably null	Het
S1pr1	A	G	3: 115,711,938	S336P	probably benign	Het
Slc24a5	A	G	2: 125,083,195	E252G	possibly damaging	Het
Slc34a2	A	T	5: 53,061,391	I184F	probably benign	Het
Slc35a3	A	G	3: 116,677,948	V224A	possibly damaging	Het
Slc39a9	A	G	12: 80,677,202	H211R	probably damaging	Het
Slu7	A	G	11: 43,439,268	N174S	probably benign	Het
Smarcd3	A	T	5: 24,595,822	Y131*	probably null	Het
Syne1	A	G	10: 5,367,621	M491T	probably benign	Het
Tars	G	A	15: 11,394,243	Q103*	probably null	Het
Tmem132d	C	A	5: 127,789,855	E660D	probably benign	Het
Ttn	T	C	2: 76,745,043	T16842A	probably damaging	Het
Ttn	T	A	2: 76,752,261	M22763L	probably benign	Het
Ttn	T	C	2: 76,812,972	E13201G	probably damaging	Het
Ubp1	A	T	9: 113,955,969	I117L	possibly damaging	Het
Usp24	T	A	4: 106,377,559	H954Q	probably benign	Het
Vmn1r174	G	A	7: 23,754,197	R96H	probably benign	Het
Vmn2r63	G	A	7: 42,928,245	Q290*	probably null	Het
Vnn3	T	C	10: 23,865,820	I341T	probably benign	Het
Wbp2nl	A	G	15: 82,305,744	T46A	probably damaging	Het
Wdr48	G	T	9: 119,924,247	E625*	probably null	Het
Wdr6	C	T	9: 108,575,164	V507I	probably damaging	Het
Zp2	A	T	7: 120,138,105	W287R	probably benign	Het

Other mutations in Myh11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Myh11	APN	16	14277722	missense	probably benign	0.00
IGL01398:Myh11	APN	16	14202100	missense	probably damaging	0.99
IGL01646:Myh11	APN	16	14221775	missense	probably damaging	1.00
IGL02470:Myh11	APN	16	14218046	missense	probably damaging	1.00
IGL02680:Myh11	APN	16	14209520	missense	probably benign	0.02
IGL02687:Myh11	APN	16	14212618	nonsense	probably null
IGL02987:Myh11	APN	16	14232532	missense	probably damaging	1.00
IGL03008:Myh11	APN	16	14204753	missense	probably benign	0.00
G5030:Myh11	UTSW	16	14250579	missense	probably damaging	1.00
PIT4618001:Myh11	UTSW	16	14201066	missense
R0008:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0085:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0086:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0087:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0096:Myh11	UTSW	16	14204367	missense	possibly damaging	0.94
R0096:Myh11	UTSW	16	14204367	missense	possibly damaging	0.94
R0207:Myh11	UTSW	16	14211260	missense	possibly damaging	0.95
R0326:Myh11	UTSW	16	14218880	missense	probably benign	0.32
R0546:Myh11	UTSW	16	14205628	missense	probably damaging	1.00
R0658:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0715:Myh11	UTSW	16	14226616	missense	possibly damaging	0.89
R0839:Myh11	UTSW	16	14203178	missense	probably damaging	1.00
R1014:Myh11	UTSW	16	14236410	missense	possibly damaging	0.70
R1104:Myh11	UTSW	16	14202127	missense	possibly damaging	0.53
R1426:Myh11	UTSW	16	14205931	nonsense	probably null
R1560:Myh11	UTSW	16	14226620	nonsense	probably null
R1714:Myh11	UTSW	16	14236368	critical splice donor site	probably null
R1742:Myh11	UTSW	16	14220044	missense	probably damaging	1.00
R1750:Myh11	UTSW	16	14200758	missense	probably damaging	1.00
R1750:Myh11	UTSW	16	14215790	missense	probably damaging	0.98
R1760:Myh11	UTSW	16	14233695	splice site	probably benign
R1829:Myh11	UTSW	16	14223880	missense	probably damaging	1.00
R1876:Myh11	UTSW	16	14269103	splice site	probably benign
R2027:Myh11	UTSW	16	14232668	missense	probably damaging	1.00
R2122:Myh11	UTSW	16	14218004	missense	probably damaging	1.00
R2247:Myh11	UTSW	16	14277559	missense	probably damaging	1.00
R2495:Myh11	UTSW	16	14205557	missense	probably damaging	1.00
R2863:Myh11	UTSW	16	14239426	missense	probably benign	0.02
R3684:Myh11	UTSW	16	14203234	missense	probably benign	0.00
R3693:Myh11	UTSW	16	14217949	missense	probably benign	0.01
R4080:Myh11	UTSW	16	14224059	missense	possibly damaging	0.83
R4367:Myh11	UTSW	16	14218883	missense	probably damaging	0.97
R4664:Myh11	UTSW	16	14226584	missense	possibly damaging	0.70
R4673:Myh11	UTSW	16	14269241	missense	probably damaging	0.99
R4694:Myh11	UTSW	16	14200702	missense	probably damaging	1.00
R4805:Myh11	UTSW	16	14234465	missense	possibly damaging	0.61
R4806:Myh11	UTSW	16	14201083	splice site	probably null
R4905:Myh11	UTSW	16	14250523	missense	probably benign	0.13
R4939:Myh11	UTSW	16	14239507	missense	probably benign
R4964:Myh11	UTSW	16	14205954	missense	probably damaging	1.00
R4966:Myh11	UTSW	16	14205954	missense	probably damaging	1.00
R5029:Myh11	UTSW	16	14205625	missense	probably damaging	1.00
R5045:Myh11	UTSW	16	14239527	nonsense	probably null
R5097:Myh11	UTSW	16	14205906	splice site	probably null
R5288:Myh11	UTSW	16	14208008	missense	possibly damaging	0.66
R5385:Myh11	UTSW	16	14208008	missense	possibly damaging	0.66
R5621:Myh11	UTSW	16	14244855	missense	probably damaging	0.96
R5856:Myh11	UTSW	16	14205976	missense	probably benign	0.00
R5869:Myh11	UTSW	16	14230800	missense	probably damaging	1.00
R6019:Myh11	UTSW	16	14206074	missense	probably damaging	1.00
R6024:Myh11	UTSW	16	14277703	missense	probably damaging	0.99
R6139:Myh11	UTSW	16	14215874	missense	probably damaging	1.00
R6209:Myh11	UTSW	16	14208291	nonsense	probably null
R6373:Myh11	UTSW	16	14205130	missense	possibly damaging	0.72
R6671:Myh11	UTSW	16	14226616	missense	possibly damaging	0.89
R6688:Myh11	UTSW	16	14205553	missense	probably damaging	1.00
R6709:Myh11	UTSW	16	14223494	critical splice donor site	probably null
R7069:Myh11	UTSW	16	14218939	missense	possibly damaging	0.95
R7176:Myh11	UTSW	16	14215826	missense
R7644:Myh11	UTSW	16	14221824	missense
R7838:Myh11	UTSW	16	14209617	missense
R7905:Myh11	UTSW	16	14207681	nonsense	probably null
R8261:Myh11	UTSW	16	14224003	missense
R8272:Myh11	UTSW	16	14218854	missense
R8317:Myh11	UTSW	16	14208077	missense
R8359:Myh11	UTSW	16	14208231	critical splice donor site	probably null
R8486:Myh11	UTSW	16	14204668	missense	possibly damaging	0.77
R8527:Myh11	UTSW	16	14230706	missense	probably damaging	1.00
R8861:Myh11	UTSW	16	14246782	missense
R8886:Myh11	UTSW	16	14234414	missense
R8946:Myh11	UTSW	16	14230716	missense	probably benign	0.08
R9151:Myh11	UTSW	16	14232575	missense
R9253:Myh11	UTSW	16	14256495	missense
R9257:Myh11	UTSW	16	14269256	missense
R9273:Myh11	UTSW	16	14236419	missense
R9320:Myh11	UTSW	16	14211288	missense
R9364:Myh11	UTSW	16	14200716	missense
R9365:Myh11	UTSW	16	14234433	missense
R9496:Myh11	UTSW	16	14230752	nonsense	probably null
R9499:Myh11	UTSW	16	14246809	missense
R9551:Myh11	UTSW	16	14246809	missense
R9554:Myh11	UTSW	16	14200716	missense
R9631:Myh11	UTSW	16	14207577	missense
X0018:Myh11	UTSW	16	14277633	missense	probably damaging	1.00
X0025:Myh11	UTSW	16	14209689	missense	possibly damaging	0.93
X0027:Myh11	UTSW	16	14234402	missense	probably damaging	1.00
Z1088:Myh11	UTSW	16	14269262	frame shift	probably null
Z1176:Myh11	UTSW	16	14239396	missense	probably null
Z1176:Myh11	UTSW	16	14277775	missense
Z1177:Myh11	UTSW	16	14209595	missense

Predicted Primers

PCR Primer
(F):5'- TGCCATGTCCTCCACCTTAGAGAAC -3'
(R):5'- CTGAAGGATCTCAAGGTCATTGCCC -3'

Sequencing Primer
(F):5'- GGATGTCATCTTTGCCAACTG -3'
(R):5'- CATTGCCCTCTTTGATAATATAAGCC -3'

Posted On

2014-05-23