Incidental Mutation 'R0017:Cabp2'
ID19379
Institutional Source Beutler Lab
Gene Symbol Cabp2
Ensembl Gene ENSMUSG00000024857
Gene Namecalcium binding protein 2
Synonyms
MMRRC Submission 038312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R0017 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location4081578-4087340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 4086242 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 83 (D83A)
Ref Sequence ENSEMBL: ENSMUSP00000124389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159148] [ENSMUST00000159556] [ENSMUST00000159593] [ENSMUST00000162908]
Predicted Effect probably benign
Transcript: ENSMUST00000159148
AA Change: D118A

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125740
Gene: ENSMUSG00000024857
AA Change: D118A

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
EFh 65 93 2.62e-5 SMART
Blast:EFh 101 126 3e-6 BLAST
EFh 139 167 1.26e-7 SMART
EFh 176 203 3.85e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159556
AA Change: D83A

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124389
Gene: ENSMUSG00000024857
AA Change: D83A

DomainStartEndE-ValueType
EFh 30 58 2.62e-5 SMART
Blast:EFh 66 91 2e-6 BLAST
EFh 104 132 1.26e-7 SMART
EFh 141 168 3.85e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159593
SMART Domains Protein: ENSMUSP00000124607
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
Pfam:EF-hand_1 65 93 2.8e-9 PFAM
Pfam:EF-hand_6 65 96 6.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162584
Predicted Effect possibly damaging
Transcript: ENSMUST00000162908
AA Change: D136A

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125255
Gene: ENSMUSG00000024857
AA Change: D136A

DomainStartEndE-ValueType
low complexity region 25 39 N/A INTRINSIC
EFh 83 111 2.62e-5 SMART
Blast:EFh 119 144 4e-6 BLAST
EFh 157 185 1.26e-7 SMART
EFh 194 221 3.85e-3 SMART
Meta Mutation Damage Score 0.5623 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.2%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a subfamily of calcium binding proteins that share similarity to calmodulin. Like calmodulin, these family members can likely stimulate calmodulin-dependent kinase II and the protein phosphatase calcineurin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous knockout affects calcium channels in cochlear inner hair cell synapses, resulting in hearing impairment. It also affects transmission of responses to light through the retinal circuits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,008,106 probably benign Het
Abca13 T A 11: 9,292,775 I1546N probably damaging Het
Actrt3 A T 3: 30,598,273 M224K probably benign Het
Adgrv1 T C 13: 81,578,946 N429S probably benign Het
Appbp2 A C 11: 85,214,303 C146G possibly damaging Het
Ccl1 A G 11: 82,178,017 probably null Het
Cdca8 T C 4: 124,920,375 T208A probably benign Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dcdc5 G A 2: 106,357,196 noncoding transcript Het
Efr3b C A 12: 3,993,003 C89F probably damaging Het
Enpp3 C T 10: 24,799,153 probably null Het
Ep400 A T 5: 110,673,529 V2467E probably damaging Het
Ermap T C 4: 119,179,948 probably benign Het
Fig4 A G 10: 41,273,007 Y150H possibly damaging Het
Fsip2 G A 2: 82,992,072 V6050M probably damaging Het
Gm11397 A C 13: 33,404,511 I360L probably damaging Het
Gnb1l T C 16: 18,541,060 W72R probably damaging Het
Gpld1 A G 13: 24,990,118 D842G probably damaging Het
Hmgcr A G 13: 96,652,089 probably benign Het
Hrc A G 7: 45,336,370 H315R possibly damaging Het
Ifit2 A T 19: 34,573,573 N171I probably damaging Het
Ipo11 T A 13: 106,886,730 I416L probably benign Het
Kcnab1 G A 3: 65,357,106 V259M probably damaging Het
Kcng4 T C 8: 119,633,520 Y39C probably damaging Het
Kif5c A G 2: 49,732,713 T526A probably benign Het
Kntc1 A G 5: 123,780,981 Y805C probably damaging Het
Mal A G 2: 127,640,307 S59P probably damaging Het
Myh15 A G 16: 49,163,060 N1513D probably damaging Het
Ncoa2 A G 1: 13,174,752 L574P probably damaging Het
Nmd3 A G 3: 69,736,092 probably null Het
Nucb2 A G 7: 116,533,151 D331G probably benign Het
Nwd1 T C 8: 72,709,425 probably benign Het
Nynrin T C 14: 55,872,395 F1653S probably damaging Het
Olfr1253 A C 2: 89,752,021 I269S possibly damaging Het
Olfr371 T A 8: 85,231,077 I194N probably benign Het
Olfr875 T G 9: 37,772,978 F106L probably benign Het
Pfdn6 T C 17: 33,939,564 R79G probably damaging Het
Pkd1 G T 17: 24,578,539 probably null Het
Pramel4 T G 4: 144,068,344 C434G probably benign Het
Ptpn13 T C 5: 103,486,772 probably null Het
Ptpro T C 6: 137,416,827 V831A probably benign Het
Rabl6 A T 2: 25,602,567 probably benign Het
Reg3b T A 6: 78,372,861 M128K possibly damaging Het
Rif1 A G 2: 52,116,674 T2207A probably benign Het
Rpa1 A C 11: 75,314,861 N223K probably null Het
Rras2 T C 7: 114,048,255 probably benign Het
Ryr1 T A 7: 29,047,542 E3760V probably damaging Het
Scyl3 T A 1: 163,939,969 I204N possibly damaging Het
Slc16a12 A G 19: 34,672,698 probably benign Het
Slc22a1 A G 17: 12,659,759 F356L probably damaging Het
Slc22a29 A G 19: 8,218,266 probably benign Het
Slc45a1 C A 4: 150,629,566 D741Y possibly damaging Het
Slco1a5 A T 6: 142,236,335 probably benign Het
Smg5 G T 3: 88,351,105 R461L probably damaging Het
Snrk T C 9: 122,166,240 S362P probably damaging Het
Spata31d1b A G 13: 59,716,069 S344G probably benign Het
Sync G A 4: 129,293,744 V190M probably damaging Het
Taf5l T C 8: 124,003,644 Y67C probably damaging Het
Tbkbp1 A G 11: 97,146,289 probably benign Het
Tshr A T 12: 91,537,886 I533F possibly damaging Het
Tsn T C 1: 118,300,859 D211G probably damaging Het
Ttn G A 2: 76,791,644 T15518I probably benign Het
Unc13c T C 9: 73,693,301 D1387G probably benign Het
Vapb A G 2: 173,771,604 T99A probably benign Het
Vmn2r-ps119 A G 17: 19,153,617 noncoding transcript Het
Zfp280d A T 9: 72,339,010 probably null Het
Other mutations in Cabp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Cabp2 APN 19 4084868 splice site probably benign
IGL02338:Cabp2 APN 19 4084154 missense possibly damaging 0.74
R0153:Cabp2 UTSW 19 4084913 splice site probably benign
R0432:Cabp2 UTSW 19 4084903 missense possibly damaging 0.59
R2027:Cabp2 UTSW 19 4087126 missense probably damaging 1.00
R3693:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R3694:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R3695:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R5935:Cabp2 UTSW 19 4086497 missense probably damaging 1.00
R5939:Cabp2 UTSW 19 4086470 missense possibly damaging 0.85
R6413:Cabp2 UTSW 19 4085698 splice site probably null
R7023:Cabp2 UTSW 19 4082658 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCAGGAAGTGTCATGCCATCATTG -3'
(R):5'- AAGTCAACCAGGCCATCTCCATTG -3'

Sequencing Primer
(F):5'- TGCCATCATTGGCATACAGG -3'
(R):5'- CATGGGATCACTGACTGAGC -3'
Posted On2013-04-11