Incidental Mutation 'R1754:Nr1i3'
ID 193806
Institutional Source Beutler Lab
Gene Symbol Nr1i3
Ensembl Gene ENSMUSG00000005677
Gene Name nuclear receptor subfamily 1, group I, member 3
Synonyms mCAR, ESTM32, CAR, CAR1, MB67, Care2
MMRRC Submission 039786-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1754 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 171041503-171046414 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 171044963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 132 (Y132H)
Ref Sequence ENSEMBL: ENSMUSP00000137683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005817] [ENSMUST00000005820] [ENSMUST00000075469] [ENSMUST00000111326] [ENSMUST00000111327] [ENSMUST00000111328] [ENSMUST00000133075] [ENSMUST00000155126] [ENSMUST00000147246] [ENSMUST00000138184] [ENSMUST00000143405]
AlphaFold O35627
Predicted Effect probably benign
Transcript: ENSMUST00000005817
SMART Domains Protein: ENSMUSP00000005817
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 7.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000005820
AA Change: Y269H

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005820
Gene: ENSMUSG00000005677
AA Change: Y269H

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 333 5.55e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000075469
AA Change: Y269H

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074915
Gene: ENSMUSG00000005677
AA Change: Y269H

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 285 8.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111326
SMART Domains Protein: ENSMUSP00000106958
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 95 9e-16 PFAM
Pfam:Porin_3 85 268 1.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111327
SMART Domains Protein: ENSMUSP00000106959
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 3.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111328
AA Change: Y268H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106960
Gene: ENSMUSG00000005677
AA Change: Y268H

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 332 5.55e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130529
Predicted Effect probably benign
Transcript: ENSMUST00000133075
SMART Domains Protein: ENSMUSP00000137852
Gene: ENSMUSG00000005677

DomainStartEndE-ValueType
ZnF_C4 18 58 1.68e-3 SMART
low complexity region 80 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137298
Predicted Effect probably damaging
Transcript: ENSMUST00000155126
AA Change: Y132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137683
Gene: ENSMUSG00000005677
AA Change: Y132H

DomainStartEndE-ValueType
HOLI 36 196 5.55e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152865
Predicted Effect probably benign
Transcript: ENSMUST00000147246
SMART Domains Protein: ENSMUSP00000119006
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 91 5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138184
SMART Domains Protein: ENSMUSP00000115877
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 119 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143405
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to TCPOBOP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,324,345 (GRCm39) L234M probably benign Het
Abca3 G A 17: 24,596,753 (GRCm39) S402N probably benign Het
Acad12 A T 5: 121,745,544 (GRCm39) V249D probably benign Het
Acp4 T C 7: 43,904,428 (GRCm39) I212V probably benign Het
Actl6a T A 3: 32,772,723 (GRCm39) V233D probably damaging Het
Aire T A 10: 77,866,124 (GRCm39) Q533L probably damaging Het
Aldh3b3 T C 19: 4,018,517 (GRCm39) S411P probably benign Het
Amer2 A G 14: 60,617,206 (GRCm39) K467R probably damaging Het
Apol9b A T 15: 77,619,962 (GRCm39) I253F probably benign Het
Arid1b A G 17: 5,329,476 (GRCm39) probably null Het
Atp6v0a4 T C 6: 38,044,764 (GRCm39) T494A probably benign Het
Atp6v1b2 A G 8: 69,554,613 (GRCm39) D106G probably benign Het
Avpr1b T C 1: 131,527,839 (GRCm39) S121P probably damaging Het
Bcl11a A C 11: 24,114,724 (GRCm39) E689A probably damaging Het
Brpf3 T G 17: 29,040,297 (GRCm39) L906R probably benign Het
Btn1a1 T C 13: 23,644,638 (GRCm39) K287E probably benign Het
Cacna1i A G 15: 80,255,730 (GRCm39) H871R probably damaging Het
Cd14 A T 18: 36,858,567 (GRCm39) L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Colgalt1 G T 8: 72,075,823 (GRCm39) W490L probably damaging Het
Ctnna2 A G 6: 77,613,732 (GRCm39) I273T possibly damaging Het
Dnah7a A T 1: 53,543,344 (GRCm39) D2275E probably benign Het
Dnah7a A C 1: 53,601,059 (GRCm39) probably null Het
Egfem1 T C 3: 29,722,482 (GRCm39) Y404H possibly damaging Het
Esm1 A T 13: 113,353,230 (GRCm39) N171Y probably damaging Het
Exoc1 T G 5: 76,708,169 (GRCm39) probably null Het
Fam243 A G 16: 92,117,919 (GRCm39) V123A probably damaging Het
Fcho1 A G 8: 72,163,890 (GRCm39) I580T probably benign Het
Fgfr1 A G 8: 26,060,226 (GRCm39) H552R probably damaging Het
Fsbp A G 4: 11,583,906 (GRCm39) R202G probably damaging Het
Gabra6 A G 11: 42,207,388 (GRCm39) V231A probably damaging Het
Gmeb1 A G 4: 131,959,338 (GRCm39) S239P probably benign Het
Gnpat T A 8: 125,603,745 (GRCm39) Y208N probably damaging Het
Il21 T C 3: 37,279,674 (GRCm39) K114R possibly damaging Het
Inhbc T C 10: 127,206,162 (GRCm39) D35G possibly damaging Het
Inpp4b A T 8: 82,497,440 (GRCm39) T87S probably damaging Het
Kcns2 T C 15: 34,839,663 (GRCm39) I342T possibly damaging Het
Ky A T 9: 102,419,126 (GRCm39) T378S possibly damaging Het
Lcat CAT C 8: 106,668,446 (GRCm39) probably null Het
Lrrc8d T C 5: 105,960,523 (GRCm39) V311A probably benign Het
Mief1 A G 15: 80,133,803 (GRCm39) I287V probably damaging Het
Mrpl47 A G 3: 32,784,233 (GRCm39) V179A probably benign Het
Mtcl1 T C 17: 66,687,178 (GRCm39) K576R probably damaging Het
Myh10 C A 11: 68,703,884 (GRCm39) A1902E probably damaging Het
Nlrp3 A G 11: 59,449,228 (GRCm39) T837A possibly damaging Het
Oit3 T C 10: 59,263,762 (GRCm39) probably null Het
Or12j4 A T 7: 140,046,773 (GRCm39) I220F probably damaging Het
Or2z2 A T 11: 58,346,088 (GRCm39) M229K probably damaging Het
Or4c100 A T 2: 88,356,159 (GRCm39) R77S probably damaging Het
Or5b113 T C 19: 13,342,717 (GRCm39) S242P probably damaging Het
Or5h25 T A 16: 58,930,944 (GRCm39) I10F probably benign Het
Or6k14 A G 1: 173,927,599 (GRCm39) T192A probably benign Het
Or7a42 T A 10: 78,791,531 (GRCm39) V164E probably damaging Het
Or9k2 G A 10: 129,999,033 (GRCm39) T54I probably benign Het
Pdlim4 T C 11: 53,946,699 (GRCm39) E196G possibly damaging Het
Pigs A G 11: 78,228,673 (GRCm39) Y293C probably damaging Het
Pkd1l2 A T 8: 117,757,458 (GRCm39) S1527T possibly damaging Het
Pkd2l1 A T 19: 44,144,040 (GRCm39) Y344* probably null Het
Pmp2 T C 3: 10,247,284 (GRCm39) probably null Het
Polr3e T C 7: 120,538,521 (GRCm39) probably null Het
Ppp3ca C G 3: 136,587,209 (GRCm39) I230M probably benign Het
Ppp5c T C 7: 16,739,235 (GRCm39) H463R probably benign Het
Ptger1 A G 8: 84,395,926 (GRCm39) N328D probably benign Het
Rhno1 A T 6: 128,334,822 (GRCm39) I167N probably benign Het
Rictor C A 15: 6,764,849 (GRCm39) P34H probably damaging Het
Rnf10 A C 5: 115,383,924 (GRCm39) S630R probably damaging Het
Rnf168 A G 16: 32,117,942 (GRCm39) Q501R probably benign Het
Rngtt T G 4: 33,329,634 (GRCm39) probably null Het
Samd9l G T 6: 3,373,126 (GRCm39) F1378L probably damaging Het
Slc9c1 T A 16: 45,409,872 (GRCm39) M864K probably benign Het
Slitrk5 T C 14: 111,917,951 (GRCm39) F525S probably damaging Het
Sox6 T C 7: 115,076,290 (GRCm39) M784V probably benign Het
Spata31e4 A T 13: 50,855,123 (GRCm39) T254S probably damaging Het
Spint2 C T 7: 28,959,791 (GRCm39) probably null Het
Ssh1 A T 5: 114,093,906 (GRCm39) I276N probably damaging Het
Trank1 T A 9: 111,221,939 (GRCm39) V2892D probably benign Het
Ttn C A 2: 76,581,384 (GRCm39) E21424* probably null Het
Usp17lc T C 7: 103,068,055 (GRCm39) I450T probably benign Het
Vcan A G 13: 89,852,854 (GRCm39) V702A probably benign Het
Vmn1r36 TA TAA 6: 66,693,517 (GRCm39) probably null Het
Vmn2r51 G T 7: 9,833,873 (GRCm39) D388E probably benign Het
Zfp106 A C 2: 120,364,245 (GRCm39) S721A probably damaging Het
Zfp106 G A 2: 120,364,244 (GRCm39) S721L probably damaging Het
Zfp189 T A 4: 49,529,342 (GRCm39) H148Q possibly damaging Het
Zfp352 A T 4: 90,112,046 (GRCm39) Y62F probably benign Het
Zfp839 T C 12: 110,821,891 (GRCm39) V235A probably damaging Het
Zfp871 T C 17: 32,994,308 (GRCm39) Y289C probably damaging Het
Other mutations in Nr1i3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Nr1i3 APN 1 171,042,541 (GRCm39) missense possibly damaging 0.79
IGL02401:Nr1i3 APN 1 171,043,942 (GRCm39) splice site probably benign
IGL02964:Nr1i3 APN 1 171,041,964 (GRCm39) missense probably benign 0.00
election UTSW 1 171,043,951 (GRCm39) missense probably damaging 0.99
R0023:Nr1i3 UTSW 1 171,044,900 (GRCm39) missense probably damaging 0.99
R0049:Nr1i3 UTSW 1 171,041,982 (GRCm39) missense probably damaging 1.00
R0049:Nr1i3 UTSW 1 171,041,982 (GRCm39) missense probably damaging 1.00
R0504:Nr1i3 UTSW 1 171,044,805 (GRCm39) splice site probably benign
R1437:Nr1i3 UTSW 1 171,044,710 (GRCm39) frame shift probably null
R1893:Nr1i3 UTSW 1 171,044,792 (GRCm39) critical splice donor site probably null
R2116:Nr1i3 UTSW 1 171,046,163 (GRCm39) missense probably damaging 1.00
R3613:Nr1i3 UTSW 1 171,042,564 (GRCm39) nonsense probably null
R3787:Nr1i3 UTSW 1 171,041,994 (GRCm39) missense probably damaging 1.00
R4627:Nr1i3 UTSW 1 171,044,014 (GRCm39) missense probably benign 0.00
R4772:Nr1i3 UTSW 1 171,044,719 (GRCm39) missense probably damaging 1.00
R4792:Nr1i3 UTSW 1 171,046,164 (GRCm39) missense probably damaging 0.99
R4880:Nr1i3 UTSW 1 171,043,951 (GRCm39) missense probably damaging 0.99
R5072:Nr1i3 UTSW 1 171,044,382 (GRCm39) missense probably benign 0.11
R5349:Nr1i3 UTSW 1 171,042,641 (GRCm39) missense possibly damaging 0.94
R5527:Nr1i3 UTSW 1 171,041,921 (GRCm39) missense possibly damaging 0.91
R6768:Nr1i3 UTSW 1 171,044,966 (GRCm39) missense probably damaging 1.00
R6824:Nr1i3 UTSW 1 171,042,542 (GRCm39) missense probably benign 0.00
R7011:Nr1i3 UTSW 1 171,041,927 (GRCm39) missense probably benign 0.02
R7092:Nr1i3 UTSW 1 171,041,747 (GRCm39) splice site probably null
R7740:Nr1i3 UTSW 1 171,044,396 (GRCm39) missense probably benign 0.00
R8200:Nr1i3 UTSW 1 171,045,266 (GRCm39) missense probably benign 0.44
R9013:Nr1i3 UTSW 1 171,042,026 (GRCm39) missense probably damaging 1.00
R9185:Nr1i3 UTSW 1 171,043,955 (GRCm39) missense possibly damaging 0.72
R9801:Nr1i3 UTSW 1 171,045,252 (GRCm39) missense probably damaging 1.00
X0027:Nr1i3 UTSW 1 171,041,946 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGTCTTACATTTGCAGTGTGCC -3'
(R):5'- TGTTCAGAATCAGCGCCATCTCC -3'

Sequencing Primer
(F):5'- CCTCTTTGCTACAAGATGGAGGAC -3'
(R):5'- CCTCACATTGTATAGGGGCTG -3'
Posted On 2014-05-23