Mutagenetix > Incidental Mutation

Incidental Mutation 'R1754:Zfp106'

193813

Institutional Source

Beutler Lab

Gene Symbol

Zfp106

Ensembl Gene

ENSMUSG00000027288

Gene Name

zinc finger protein 106

Synonyms

Cd-1, H3a, Sh3bp3, sirm

MMRRC Submission

039786-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1754 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120506820-120563843 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 120533764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 721 (S721A)

Ref Sequence

ENSEMBL: ENSMUSP00000128995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000055241
AA Change: S744A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: S744A

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	1.51e0	SMART
ZnF_C2H2	43	67	7.18e1	SMART
low complexity region	75	92	N/A	INTRINSIC
low complexity region	141	152	N/A	INTRINSIC
low complexity region	199	212	N/A	INTRINSIC
low complexity region	466	480	N/A	INTRINSIC
coiled coil region	800	823	N/A	INTRINSIC
low complexity region	842	856	N/A	INTRINSIC
low complexity region	1049	1062	N/A	INTRINSIC
low complexity region	1312	1321	N/A	INTRINSIC
low complexity region	1361	1373	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
WD40	1525	1562	9.24e-4	SMART
WD40	1565	1607	1.83e-7	SMART
PQQ	1587	1618	3.42e2	SMART
WD40	1651	1691	3.45e-1	SMART
PQQ	1671	1702	9.14e1	SMART
WD40	1694	1731	2.12e-3	SMART
PQQ	1711	1742	6.42e0	SMART
WD40	1734	1771	6e-3	SMART
PQQ	1751	1782	5.7e2	SMART
WD40	1774	1811	3.58e-1	SMART
ZnF_C2H2	1818	1843	5.34e-1	SMART
ZnF_C2H2	1851	1879	1.31e2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135625

SMART Domains

Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	1.51e0	SMART
low complexity region	53	67	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141874

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147353

Predicted Effect

probably benign
Transcript: ENSMUST00000163384

Predicted Effect

probably benign
Transcript: ENSMUST00000167241

SMART Domains

Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

Domain	Start	End	E-Value	Type
ZnF_C2H2	4	28	1.51e0	SMART
low complexity region	74	85	N/A	INTRINSIC
low complexity region	132	145	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171215
AA Change: S721A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: S721A

Domain	Start	End	E-Value	Type
ZnF_C2H2	20	44	7.18e1	SMART
low complexity region	52	69	N/A	INTRINSIC
low complexity region	118	129	N/A	INTRINSIC
low complexity region	176	189	N/A	INTRINSIC
low complexity region	443	457	N/A	INTRINSIC
coiled coil region	777	800	N/A	INTRINSIC
low complexity region	819	833	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1289	1298	N/A	INTRINSIC
low complexity region	1338	1350	N/A	INTRINSIC
low complexity region	1366	1386	N/A	INTRINSIC
WD40	1502	1539	9.24e-4	SMART
WD40	1542	1584	1.83e-7	SMART
PQQ	1564	1595	3.42e2	SMART
WD40	1628	1668	3.45e-1	SMART
PQQ	1648	1679	9.14e1	SMART
WD40	1671	1708	2.12e-3	SMART
PQQ	1688	1719	6.42e0	SMART
WD40	1711	1748	6e-3	SMART
PQQ	1728	1759	5.7e2	SMART
WD40	1751	1788	3.58e-1	SMART
ZnF_C2H2	1795	1820	5.34e-1	SMART
ZnF_C2H2	1828	1856	1.31e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181963

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563D23Rik	A	G	16: 92,321,031	V123A	probably damaging	Het
Abca2	T	A	2: 25,434,333	L234M	probably benign	Het
Abca3	G	A	17: 24,377,779	S402N	probably benign	Het
Acad12	A	T	5: 121,607,481	V249D	probably benign	Het
Acp4	T	C	7: 44,255,004	I212V	probably benign	Het
Actl6a	T	A	3: 32,718,574	V233D	probably damaging	Het
Aire	T	A	10: 78,030,290	Q533L	probably damaging	Het
Aldh3b3	T	C	19: 3,968,517	S411P	probably benign	Het
Amer2	A	G	14: 60,379,757	K467R	probably damaging	Het
Apol9b	A	T	15: 77,735,762	I253F	probably benign	Het
Arid1b	A	G	17: 5,279,201		probably null	Het
Atp6v0a4	T	C	6: 38,067,829	T494A	probably benign	Het
Atp6v1b2	A	G	8: 69,101,961	D106G	probably benign	Het
Avpr1b	T	C	1: 131,600,101	S121P	probably damaging	Het
Bcl11a	A	C	11: 24,164,724	E689A	probably damaging	Het
Brpf3	T	G	17: 28,821,323	L906R	probably benign	Het
Btn1a1	T	C	13: 23,460,468	K287E	probably benign	Het
Cacna1i	A	G	15: 80,371,529	H871R	probably damaging	Het
Cd14	A	T	18: 36,725,514	L296Q	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Colgalt1	G	T	8: 71,623,179	W490L	probably damaging	Het
Ctnna2	A	G	6: 77,636,749	I273T	possibly damaging	Het
Dnah7a	A	T	1: 53,504,185	D2275E	probably benign	Het
Dnah7a	A	C	1: 53,561,900		probably null	Het
Egfem1	T	C	3: 29,668,333	Y404H	possibly damaging	Het
Esm1	A	T	13: 113,216,696	N171Y	probably damaging	Het
Exoc1	T	G	5: 76,560,322		probably null	Het
Fcho1	A	G	8: 71,711,246	I580T	probably benign	Het
Fgfr1	A	G	8: 25,570,210	H552R	probably damaging	Het
Fsbp	A	G	4: 11,583,906	R202G	probably damaging	Het
Gabra6	A	G	11: 42,316,561	V231A	probably damaging	Het
Gm8765	A	T	13: 50,701,087	T254S	probably damaging	Het
Gmeb1	A	G	4: 132,232,027	S239P	probably benign	Het
Gnpat	T	A	8: 124,877,006	Y208N	probably damaging	Het
Il21	T	C	3: 37,225,525	K114R	possibly damaging	Het
Inhbc	T	C	10: 127,370,293	D35G	possibly damaging	Het
Inpp4b	A	T	8: 81,770,811	T87S	probably damaging	Het
Kcns2	T	C	15: 34,839,517	I342T	possibly damaging	Het
Ky	A	T	9: 102,541,927	T378S	possibly damaging	Het
Lcat	CAT	C	8: 105,941,814		probably null	Het
Lrrc8d	T	C	5: 105,812,657	V311A	probably benign	Het
Mief1	A	G	15: 80,249,602	I287V	probably damaging	Het
Mrpl47	A	G	3: 32,730,084	V179A	probably benign	Het
Mtcl1	T	C	17: 66,380,183	K576R	probably damaging	Het
Myh10	C	A	11: 68,813,058	A1902E	probably damaging	Het
Nlrp3	A	G	11: 59,558,402	T837A	possibly damaging	Het
Nr1i3	T	C	1: 171,217,394	Y132H	probably damaging	Het
Oit3	T	C	10: 59,427,940		probably null	Het
Olfr1186	A	T	2: 88,525,815	R77S	probably damaging	Het
Olfr1467	T	C	19: 13,365,353	S242P	probably damaging	Het
Olfr193	T	A	16: 59,110,581	I10F	probably benign	Het
Olfr30	A	T	11: 58,455,262	M229K	probably damaging	Het
Olfr427	A	G	1: 174,100,033	T192A	probably benign	Het
Olfr533	A	T	7: 140,466,860	I220F	probably damaging	Het
Olfr8	T	A	10: 78,955,697	V164E	probably damaging	Het
Olfr825	G	A	10: 130,163,164	T54I	probably benign	Het
Pdlim4	T	C	11: 54,055,873	E196G	possibly damaging	Het
Pigs	A	G	11: 78,337,847	Y293C	probably damaging	Het
Pkd1l2	A	T	8: 117,030,719	S1527T	possibly damaging	Het
Pkd2l1	A	T	19: 44,155,601	Y344*	probably null	Het
Pmp2	T	C	3: 10,182,224		probably null	Het
Polr3e	T	C	7: 120,939,298		probably null	Het
Ppp3ca	C	G	3: 136,881,448	I230M	probably benign	Het
Ppp5c	T	C	7: 17,005,310	H463R	probably benign	Het
Ptger1	A	G	8: 83,669,297	N328D	probably benign	Het
Rhno1	A	T	6: 128,357,859	I167N	probably benign	Het
Rictor	C	A	15: 6,735,368	P34H	probably damaging	Het
Rnf10	A	C	5: 115,245,865	S630R	probably damaging	Het
Rnf168	A	G	16: 32,299,124	Q501R	probably benign	Het
Rngtt	T	G	4: 33,329,634		probably null	Het
Samd9l	G	T	6: 3,373,126	F1378L	probably damaging	Het
Slc9c1	T	A	16: 45,589,509	M864K	probably benign	Het
Slitrk5	T	C	14: 111,680,519	F525S	probably damaging	Het
Sox6	T	C	7: 115,477,055	M784V	probably benign	Het
Spint2	C	T	7: 29,260,366		probably null	Het
Ssh1	A	T	5: 113,955,845	I276N	probably damaging	Het
Trank1	T	A	9: 111,392,871	V2892D	probably benign	Het
Ttn	C	A	2: 76,751,040	E21424*	probably null	Het
Usp17lc	T	C	7: 103,418,848	I450T	probably benign	Het
Vcan	A	G	13: 89,704,735	V702A	probably benign	Het
Vmn1r36	TA	TAA	6: 66,716,533		probably null	Het
Vmn2r51	G	T	7: 10,099,946	D388E	probably benign	Het
Zfp189	T	A	4: 49,529,342	H148Q	possibly damaging	Het
Zfp352	A	T	4: 90,223,809	Y62F	probably benign	Het
Zfp839	T	C	12: 110,855,457	V235A	probably damaging	Het
Zfp871	T	C	17: 32,775,334	Y289C	probably damaging	Het

Other mutations in Zfp106

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Zfp106	APN	2	120539497	missense	probably benign	0.45
IGL00816:Zfp106	APN	2	120526848	missense	probably benign	0.02
IGL00822:Zfp106	APN	2	120514160	missense	probably damaging	1.00
IGL00848:Zfp106	APN	2	120512727	missense	probably damaging	1.00
IGL01293:Zfp106	APN	2	120535035	missense	possibly damaging	0.92
IGL01323:Zfp106	APN	2	120524464	missense	possibly damaging	0.74
IGL01662:Zfp106	APN	2	120523553	missense	probably benign	0.17
IGL01683:Zfp106	APN	2	120524555	missense	probably benign	0.00
IGL01809:Zfp106	APN	2	120533671	missense	probably damaging	1.00
IGL01958:Zfp106	APN	2	120534807	missense	probably benign	0.26
IGL01960:Zfp106	APN	2	120524043	missense	probably damaging	0.99
IGL01960:Zfp106	APN	2	120539322	missense	probably benign	0.08
IGL02168:Zfp106	APN	2	120534231	missense	possibly damaging	0.90
IGL02623:Zfp106	APN	2	120545914	splice site	probably null
IGL02798:Zfp106	APN	2	120510510	missense	probably damaging	1.00
IGL02828:Zfp106	APN	2	120531697	missense	possibly damaging	0.86
IGL03022:Zfp106	APN	2	120528639	splice site	probably benign
IGL03308:Zfp106	APN	2	120524024	missense	probably benign	0.00
IGL03324:Zfp106	APN	2	120535387	missense	probably benign	0.01
lepton	UTSW	2	120532104	missense	probably damaging	0.98
Proton	UTSW	2	120510534	missense	probably damaging	1.00
quark	UTSW	2	120535060	nonsense	probably null
R0040_zfp106_031	UTSW	2	120531613	missense	probably damaging	1.00
string	UTSW	2	120533594	missense	probably damaging	0.96
theory	UTSW	2	120533677	nonsense	probably null
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0135:Zfp106	UTSW	2	120520487	missense	probably damaging	0.99
R0180:Zfp106	UTSW	2	120533875	missense	probably damaging	0.96
R0387:Zfp106	UTSW	2	120528472	splice site	probably null
R0558:Zfp106	UTSW	2	120532196	missense	probably damaging	1.00
R0680:Zfp106	UTSW	2	120527016	missense	probably damaging	1.00
R0729:Zfp106	UTSW	2	120555248	missense	probably damaging	0.99
R0828:Zfp106	UTSW	2	120535603	missense	probably benign	0.00
R1124:Zfp106	UTSW	2	120534714	missense	probably benign	0.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1226:Zfp106	UTSW	2	120524079	missense	probably damaging	1.00
R1239:Zfp106	UTSW	2	120533594	missense	probably damaging	0.96
R1634:Zfp106	UTSW	2	120533677	nonsense	probably null
R1754:Zfp106	UTSW	2	120533763	missense	probably damaging	0.96
R1755:Zfp106	UTSW	2	120535175	missense	probably damaging	1.00
R1763:Zfp106	UTSW	2	120520428	missense	probably benign	0.03
R1875:Zfp106	UTSW	2	120513615	critical splice donor site	probably null
R1903:Zfp106	UTSW	2	120526848	missense	probably benign	0.02
R1932:Zfp106	UTSW	2	120531681	missense	possibly damaging	0.80
R2070:Zfp106	UTSW	2	120523529	missense	probably benign	0.11
R2301:Zfp106	UTSW	2	120535650	missense	probably benign	0.04
R3429:Zfp106	UTSW	2	120527063	missense	probably benign	0.00
R3720:Zfp106	UTSW	2	120534599	missense	probably benign	0.01
R3875:Zfp106	UTSW	2	120534613	missense	probably benign	0.08
R3881:Zfp106	UTSW	2	120532149	missense	probably benign	0.01
R3921:Zfp106	UTSW	2	120533616	missense	probably damaging	1.00
R3923:Zfp106	UTSW	2	120534856	missense	probably damaging	0.99
R4087:Zfp106	UTSW	2	120526899	splice site	probably null
R4678:Zfp106	UTSW	2	120533740	missense	probably damaging	1.00
R4965:Zfp106	UTSW	2	120533919	missense	probably damaging	0.98
R5011:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5013:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5151:Zfp106	UTSW	2	120534727	missense	probably benign	0.01
R5227:Zfp106	UTSW	2	120523968	missense	probably benign	0.11
R5328:Zfp106	UTSW	2	120520417	missense	possibly damaging	0.73
R5403:Zfp106	UTSW	2	120534781	missense	probably benign	0.02
R5624:Zfp106	UTSW	2	120531957	missense	probably damaging	0.99
R5686:Zfp106	UTSW	2	120533507	splice site	probably null
R5691:Zfp106	UTSW	2	120524471	missense	probably damaging	0.99
R5852:Zfp106	UTSW	2	120516006	missense	probably damaging	1.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6298:Zfp106	UTSW	2	120522704	missense	probably damaging	1.00
R6409:Zfp106	UTSW	2	120532104	missense	probably damaging	0.98
R6505:Zfp106	UTSW	2	120534502	missense	probably damaging	0.99
R6598:Zfp106	UTSW	2	120535060	nonsense	probably null
R6765:Zfp106	UTSW	2	120539454	missense	probably damaging	0.96
R7013:Zfp106	UTSW	2	120531632	missense	probably damaging	0.99
R7453:Zfp106	UTSW	2	120510527	missense	probably damaging	1.00
R7453:Zfp106	UTSW	2	120545919	splice site	probably null
R7643:Zfp106	UTSW	2	120512734	missense	probably benign	0.01
R7829:Zfp106	UTSW	2	120524057	missense	possibly damaging	0.94
R7897:Zfp106	UTSW	2	120535615	nonsense	probably null
R7909:Zfp106	UTSW	2	120514219	missense	probably damaging	1.00
R8054:Zfp106	UTSW	2	120524519	missense	possibly damaging	0.93
R8124:Zfp106	UTSW	2	120524331	missense	probably benign	0.44
R8203:Zfp106	UTSW	2	120519078	missense	probably damaging	1.00
R8350:Zfp106	UTSW	2	120535618	missense
R8450:Zfp106	UTSW	2	120535618	missense
R8698:Zfp106	UTSW	2	120524119	critical splice donor site	probably null
R8985:Zfp106	UTSW	2	120535596	missense
R9015:Zfp106	UTSW	2	120533538	missense	probably damaging	1.00
R9036:Zfp106	UTSW	2	120539425	missense	probably damaging	1.00
R9142:Zfp106	UTSW	2	120520454	missense	probably damaging	1.00
R9154:Zfp106	UTSW	2	120534331	nonsense	probably null
R9175:Zfp106	UTSW	2	120522716	missense	probably damaging	1.00
R9529:Zfp106	UTSW	2	120520526	missense	probably damaging	0.97
R9572:Zfp106	UTSW	2	120519078	missense	probably damaging	1.00
R9581:Zfp106	UTSW	2	120535326	missense
RF008:Zfp106	UTSW	2	120524545	small deletion	probably benign
RF025:Zfp106	UTSW	2	120524545	small deletion	probably benign
X0025:Zfp106	UTSW	2	120534816	missense	probably benign
Z1088:Zfp106	UTSW	2	120530490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGCTGAATGACCTGTTCCCAG -3'
(R):5'- CACAGTTCTCCAGAAAGAGGCTGAG -3'

Sequencing Primer
(F):5'- AGTTGACATTTCTCCTTGATGC -3'
(R):5'- GGCTTACTGCTAAACTTGAAGACC -3'

Posted On

2014-05-23