Mutagenetix > Incidental Mutation

Incidental Mutation 'R1754:Mrpl47'

193817

Institutional Source

Beutler Lab

Gene Symbol

Mrpl47

Ensembl Gene

ENSMUSG00000037531

Gene Name

mitochondrial ribosomal protein L47

Synonyms

CGI-204, 4833424P18Rik, NCM1

MMRRC Submission

039786-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1754 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32725397-32737605 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32730084 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 179 (V179A)

Ref Sequence

ENSEMBL: ENSMUSP00000048078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029214] [ENSMUST00000043966]

AlphaFold

Q8K2Y7

Predicted Effect

probably benign
Transcript: ENSMUST00000029214

SMART Domains

Protein: ENSMUSP00000029214
Gene: ENSMUSG00000027671

Domain	Start	End	E-Value	Type
ACTIN	11	429	1.37e-189	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000043966
AA Change: V179A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000048078
Gene: ENSMUSG00000037531
AA Change: V179A

Domain	Start	End	E-Value	Type
Pfam:MRP-L47	66	151	4.6e-40	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153564

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153779

Predicted Effect

probably benign
Transcript: ENSMUST00000193231

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. This gene is immediately adjacent to the gene for BRG1/brm-associated factor 53A (also known as BAF complex 53 kDa subunit protein A in humans) in a tail-to-tail orientation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563D23Rik	A	G	16: 92,321,031	V123A	probably damaging	Het
Abca2	T	A	2: 25,434,333	L234M	probably benign	Het
Abca3	G	A	17: 24,377,779	S402N	probably benign	Het
Acad12	A	T	5: 121,607,481	V249D	probably benign	Het
Acp4	T	C	7: 44,255,004	I212V	probably benign	Het
Actl6a	T	A	3: 32,718,574	V233D	probably damaging	Het
Aire	T	A	10: 78,030,290	Q533L	probably damaging	Het
Aldh3b3	T	C	19: 3,968,517	S411P	probably benign	Het
Amer2	A	G	14: 60,379,757	K467R	probably damaging	Het
Apol9b	A	T	15: 77,735,762	I253F	probably benign	Het
Arid1b	A	G	17: 5,279,201		probably null	Het
Atp6v0a4	T	C	6: 38,067,829	T494A	probably benign	Het
Atp6v1b2	A	G	8: 69,101,961	D106G	probably benign	Het
Avpr1b	T	C	1: 131,600,101	S121P	probably damaging	Het
Bcl11a	A	C	11: 24,164,724	E689A	probably damaging	Het
Brpf3	T	G	17: 28,821,323	L906R	probably benign	Het
Btn1a1	T	C	13: 23,460,468	K287E	probably benign	Het
Cacna1i	A	G	15: 80,371,529	H871R	probably damaging	Het
Cd14	A	T	18: 36,725,514	L296Q	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Colgalt1	G	T	8: 71,623,179	W490L	probably damaging	Het
Ctnna2	A	G	6: 77,636,749	I273T	possibly damaging	Het
Dnah7a	A	T	1: 53,504,185	D2275E	probably benign	Het
Dnah7a	A	C	1: 53,561,900		probably null	Het
Egfem1	T	C	3: 29,668,333	Y404H	possibly damaging	Het
Esm1	A	T	13: 113,216,696	N171Y	probably damaging	Het
Exoc1	T	G	5: 76,560,322		probably null	Het
Fcho1	A	G	8: 71,711,246	I580T	probably benign	Het
Fgfr1	A	G	8: 25,570,210	H552R	probably damaging	Het
Fsbp	A	G	4: 11,583,906	R202G	probably damaging	Het
Gabra6	A	G	11: 42,316,561	V231A	probably damaging	Het
Gm8765	A	T	13: 50,701,087	T254S	probably damaging	Het
Gmeb1	A	G	4: 132,232,027	S239P	probably benign	Het
Gnpat	T	A	8: 124,877,006	Y208N	probably damaging	Het
Il21	T	C	3: 37,225,525	K114R	possibly damaging	Het
Inhbc	T	C	10: 127,370,293	D35G	possibly damaging	Het
Inpp4b	A	T	8: 81,770,811	T87S	probably damaging	Het
Kcns2	T	C	15: 34,839,517	I342T	possibly damaging	Het
Ky	A	T	9: 102,541,927	T378S	possibly damaging	Het
Lcat	CAT	C	8: 105,941,814		probably null	Het
Lrrc8d	T	C	5: 105,812,657	V311A	probably benign	Het
Mief1	A	G	15: 80,249,602	I287V	probably damaging	Het
Mtcl1	T	C	17: 66,380,183	K576R	probably damaging	Het
Myh10	C	A	11: 68,813,058	A1902E	probably damaging	Het
Nlrp3	A	G	11: 59,558,402	T837A	possibly damaging	Het
Nr1i3	T	C	1: 171,217,394	Y132H	probably damaging	Het
Oit3	T	C	10: 59,427,940		probably null	Het
Olfr1186	A	T	2: 88,525,815	R77S	probably damaging	Het
Olfr1467	T	C	19: 13,365,353	S242P	probably damaging	Het
Olfr193	T	A	16: 59,110,581	I10F	probably benign	Het
Olfr30	A	T	11: 58,455,262	M229K	probably damaging	Het
Olfr427	A	G	1: 174,100,033	T192A	probably benign	Het
Olfr533	A	T	7: 140,466,860	I220F	probably damaging	Het
Olfr8	T	A	10: 78,955,697	V164E	probably damaging	Het
Olfr825	G	A	10: 130,163,164	T54I	probably benign	Het
Pdlim4	T	C	11: 54,055,873	E196G	possibly damaging	Het
Pigs	A	G	11: 78,337,847	Y293C	probably damaging	Het
Pkd1l2	A	T	8: 117,030,719	S1527T	possibly damaging	Het
Pkd2l1	A	T	19: 44,155,601	Y344*	probably null	Het
Pmp2	T	C	3: 10,182,224		probably null	Het
Polr3e	T	C	7: 120,939,298		probably null	Het
Ppp3ca	C	G	3: 136,881,448	I230M	probably benign	Het
Ppp5c	T	C	7: 17,005,310	H463R	probably benign	Het
Ptger1	A	G	8: 83,669,297	N328D	probably benign	Het
Rhno1	A	T	6: 128,357,859	I167N	probably benign	Het
Rictor	C	A	15: 6,735,368	P34H	probably damaging	Het
Rnf10	A	C	5: 115,245,865	S630R	probably damaging	Het
Rnf168	A	G	16: 32,299,124	Q501R	probably benign	Het
Rngtt	T	G	4: 33,329,634		probably null	Het
Samd9l	G	T	6: 3,373,126	F1378L	probably damaging	Het
Slc9c1	T	A	16: 45,589,509	M864K	probably benign	Het
Slitrk5	T	C	14: 111,680,519	F525S	probably damaging	Het
Sox6	T	C	7: 115,477,055	M784V	probably benign	Het
Spint2	C	T	7: 29,260,366		probably null	Het
Ssh1	A	T	5: 113,955,845	I276N	probably damaging	Het
Trank1	T	A	9: 111,392,871	V2892D	probably benign	Het
Ttn	C	A	2: 76,751,040	E21424*	probably null	Het
Usp17lc	T	C	7: 103,418,848	I450T	probably benign	Het
Vcan	A	G	13: 89,704,735	V702A	probably benign	Het
Vmn1r36	TA	TAA	6: 66,716,533		probably null	Het
Vmn2r51	G	T	7: 10,099,946	D388E	probably benign	Het
Zfp106	G	A	2: 120,533,763	S721L	probably damaging	Het
Zfp106	A	C	2: 120,533,764	S721A	probably damaging	Het
Zfp189	T	A	4: 49,529,342	H148Q	possibly damaging	Het
Zfp352	A	T	4: 90,223,809	Y62F	probably benign	Het
Zfp839	T	C	12: 110,855,457	V235A	probably damaging	Het
Zfp871	T	C	17: 32,775,334	Y289C	probably damaging	Het

Other mutations in Mrpl47

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02408:Mrpl47	APN	3	32736640	critical splice donor site	probably null
R0555:Mrpl47	UTSW	3	32736693	missense	probably benign
R0885:Mrpl47	UTSW	3	32730186	missense	probably damaging	0.98
R4466:Mrpl47	UTSW	3	32730091	nonsense	probably null
R4751:Mrpl47	UTSW	3	32728441	missense	probably benign
R5116:Mrpl47	UTSW	3	32733601	missense	probably damaging	0.98
R8250:Mrpl47	UTSW	3	32731233	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTCAAGAACCCCAAGTTCTTAGTGC -3'
(R):5'- AAGTTCCCGCTTTGTGGATGCC -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- AGGTGACGGCTAAAGTTAGC -3'

Posted On

2014-05-23