Incidental Mutation 'R1754:Rnf10'
Institutional Source Beutler Lab
Gene Symbol Rnf10
Ensembl Gene ENSMUSG00000041740
Gene Namering finger protein 10
MMRRC Submission 039786-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R1754 (G1)
Quality Score225
Status Not validated
Chromosomal Location115241412-115272898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 115245865 bp
Amino Acid Change Serine to Arginine at position 630 (S630R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040555] [ENSMUST00000081497] [ENSMUST00000112096] [ENSMUST00000112097] [ENSMUST00000135455]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040555
AA Change: S668R

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041778
Gene: ENSMUSG00000041740
AA Change: S668R

low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081497
SMART Domains Protein: ENSMUSP00000080215
Gene: ENSMUSG00000060152

Pfam:RNase_P_Rpp14 7 115 2.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112096
AA Change: S668R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107725
Gene: ENSMUSG00000041740
AA Change: S668R

low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 782 793 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112097
AA Change: S669R

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107726
Gene: ENSMUSG00000041740
AA Change: S669R

low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 440 462 N/A INTRINSIC
low complexity region 592 619 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128954
Predicted Effect probably benign
Transcript: ENSMUST00000135455
SMART Domains Protein: ENSMUSP00000118408
Gene: ENSMUSG00000060152

Pfam:RNase_P_Rpp14 7 117 3.7e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139853
AA Change: S630R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131696
Gene: ENSMUSG00000041740
AA Change: S630R

low complexity region 41 53 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
RING 188 229 1.98e-8 SMART
low complexity region 342 363 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 554 581 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153553
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoding this gene is a member of the really interesting new gene finger protein family. Members of this family contain protein motifs similar to zinc finger domains and are involved in many processes that include transcriptional regulation, DNA repair and signal transduction. Expression of this gene is upregulated during neuronal differentiation of cultured cells, and inhibition of its expression impairs differentiation and cell cycle exit, providing evidence for a function in neuronal differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca2 T A 2: 25,434,333 L234M probably benign Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Acp4 T C 7: 44,255,004 I212V probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Arid1b A G 17: 5,279,201 probably null Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Dnah7a A C 1: 53,561,900 probably null Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gmeb1 A G 4: 132,232,027 S239P probably benign Het
Gnpat T A 8: 124,877,006 Y208N probably damaging Het
Il21 T C 3: 37,225,525 K114R possibly damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Myh10 C A 11: 68,813,058 A1902E probably damaging Het
Nlrp3 A G 11: 59,558,402 T837A possibly damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Ptger1 A G 8: 83,669,297 N328D probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Ssh1 A T 5: 113,955,845 I276N probably damaging Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Rnf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Rnf10 APN 5 115256983 missense probably damaging 1.00
IGL01995:Rnf10 APN 5 115251102 nonsense probably null
IGL02291:Rnf10 APN 5 115260196 missense probably damaging 1.00
IGL02751:Rnf10 APN 5 115242666 missense probably benign 0.20
IGL02897:Rnf10 APN 5 115248641 missense probably benign
IGL02968:Rnf10 APN 5 115245888 missense probably benign 0.05
IGL03008:Rnf10 APN 5 115251296 missense possibly damaging 0.92
IGL03098:Rnf10 UTSW 5 115272367 missense probably damaging 1.00
R0409:Rnf10 UTSW 5 115255447 splice site probably benign
R1083:Rnf10 UTSW 5 115260104 splice site probably benign
R1957:Rnf10 UTSW 5 115260322 splice site probably benign
R2398:Rnf10 UTSW 5 115247273 missense probably benign 0.33
R2848:Rnf10 UTSW 5 115249112 missense probably benign
R2849:Rnf10 UTSW 5 115249112 missense probably benign
R4527:Rnf10 UTSW 5 115260151 missense probably damaging 0.96
R4617:Rnf10 UTSW 5 115248703 missense probably damaging 1.00
R4673:Rnf10 UTSW 5 115251089 missense probably damaging 0.99
R4823:Rnf10 UTSW 5 115255442 critical splice acceptor site probably null
R5560:Rnf10 UTSW 5 115249998 missense probably damaging 1.00
R5805:Rnf10 UTSW 5 115244068 missense probably benign
R6192:Rnf10 UTSW 5 115257077 missense probably damaging 1.00
R7061:Rnf10 UTSW 5 115257090 missense probably damaging 0.98
R7206:Rnf10 UTSW 5 115244121 missense probably benign 0.04
R7213:Rnf10 UTSW 5 115242473 missense probably damaging 1.00
R7213:Rnf10 UTSW 5 115242474 missense probably damaging 1.00
R7429:Rnf10 UTSW 5 115248680 missense probably damaging 1.00
R8098:Rnf10 UTSW 5 115251379 missense probably damaging 0.98
R8179:Rnf10 UTSW 5 115260117 frame shift probably null
R8252:Rnf10 UTSW 5 115260314 missense probably benign 0.03
R8357:Rnf10 UTSW 5 115272261 missense possibly damaging 0.54
R8457:Rnf10 UTSW 5 115272261 missense possibly damaging 0.54
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcccagcatccattaactcc -3'
Posted On2014-05-23