Incidental Mutation 'R1754:Rnf10'
ID 193827
Institutional Source Beutler Lab
Gene Symbol Rnf10
Ensembl Gene ENSMUSG00000041740
Gene Name ring finger protein 10
Synonyms
MMRRC Submission 039786-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.700) question?
Stock # R1754 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 115379829-115410980 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 115383924 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 630 (S630R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040555] [ENSMUST00000081497] [ENSMUST00000112096] [ENSMUST00000112097] [ENSMUST00000135455]
AlphaFold Q3UIW5
Predicted Effect possibly damaging
Transcript: ENSMUST00000040555
AA Change: S668R

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041778
Gene: ENSMUSG00000041740
AA Change: S668R

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081497
SMART Domains Protein: ENSMUSP00000080215
Gene: ENSMUSG00000060152

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 7 115 2.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112096
AA Change: S668R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107725
Gene: ENSMUSG00000041740
AA Change: S668R

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 782 793 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112097
AA Change: S669R

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107726
Gene: ENSMUSG00000041740
AA Change: S669R

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 440 462 N/A INTRINSIC
low complexity region 592 619 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128954
Predicted Effect probably damaging
Transcript: ENSMUST00000139853
AA Change: S630R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131696
Gene: ENSMUSG00000041740
AA Change: S630R

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
RING 188 229 1.98e-8 SMART
low complexity region 342 363 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 554 581 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152613
Predicted Effect probably benign
Transcript: ENSMUST00000135455
SMART Domains Protein: ENSMUSP00000118408
Gene: ENSMUSG00000060152

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 7 117 3.7e-31 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoding this gene is a member of the really interesting new gene finger protein family. Members of this family contain protein motifs similar to zinc finger domains and are involved in many processes that include transcriptional regulation, DNA repair and signal transduction. Expression of this gene is upregulated during neuronal differentiation of cultured cells, and inhibition of its expression impairs differentiation and cell cycle exit, providing evidence for a function in neuronal differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,324,345 (GRCm39) L234M probably benign Het
Abca3 G A 17: 24,596,753 (GRCm39) S402N probably benign Het
Acad12 A T 5: 121,745,544 (GRCm39) V249D probably benign Het
Acp4 T C 7: 43,904,428 (GRCm39) I212V probably benign Het
Actl6a T A 3: 32,772,723 (GRCm39) V233D probably damaging Het
Aire T A 10: 77,866,124 (GRCm39) Q533L probably damaging Het
Aldh3b3 T C 19: 4,018,517 (GRCm39) S411P probably benign Het
Amer2 A G 14: 60,617,206 (GRCm39) K467R probably damaging Het
Apol9b A T 15: 77,619,962 (GRCm39) I253F probably benign Het
Arid1b A G 17: 5,329,476 (GRCm39) probably null Het
Atp6v0a4 T C 6: 38,044,764 (GRCm39) T494A probably benign Het
Atp6v1b2 A G 8: 69,554,613 (GRCm39) D106G probably benign Het
Avpr1b T C 1: 131,527,839 (GRCm39) S121P probably damaging Het
Bcl11a A C 11: 24,114,724 (GRCm39) E689A probably damaging Het
Brpf3 T G 17: 29,040,297 (GRCm39) L906R probably benign Het
Btn1a1 T C 13: 23,644,638 (GRCm39) K287E probably benign Het
Cacna1i A G 15: 80,255,730 (GRCm39) H871R probably damaging Het
Cd14 A T 18: 36,858,567 (GRCm39) L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Colgalt1 G T 8: 72,075,823 (GRCm39) W490L probably damaging Het
Ctnna2 A G 6: 77,613,732 (GRCm39) I273T possibly damaging Het
Dnah7a A T 1: 53,543,344 (GRCm39) D2275E probably benign Het
Dnah7a A C 1: 53,601,059 (GRCm39) probably null Het
Egfem1 T C 3: 29,722,482 (GRCm39) Y404H possibly damaging Het
Esm1 A T 13: 113,353,230 (GRCm39) N171Y probably damaging Het
Exoc1 T G 5: 76,708,169 (GRCm39) probably null Het
Fam243 A G 16: 92,117,919 (GRCm39) V123A probably damaging Het
Fcho1 A G 8: 72,163,890 (GRCm39) I580T probably benign Het
Fgfr1 A G 8: 26,060,226 (GRCm39) H552R probably damaging Het
Fsbp A G 4: 11,583,906 (GRCm39) R202G probably damaging Het
Gabra6 A G 11: 42,207,388 (GRCm39) V231A probably damaging Het
Gmeb1 A G 4: 131,959,338 (GRCm39) S239P probably benign Het
Gnpat T A 8: 125,603,745 (GRCm39) Y208N probably damaging Het
Il21 T C 3: 37,279,674 (GRCm39) K114R possibly damaging Het
Inhbc T C 10: 127,206,162 (GRCm39) D35G possibly damaging Het
Inpp4b A T 8: 82,497,440 (GRCm39) T87S probably damaging Het
Kcns2 T C 15: 34,839,663 (GRCm39) I342T possibly damaging Het
Ky A T 9: 102,419,126 (GRCm39) T378S possibly damaging Het
Lcat CAT C 8: 106,668,446 (GRCm39) probably null Het
Lrrc8d T C 5: 105,960,523 (GRCm39) V311A probably benign Het
Mief1 A G 15: 80,133,803 (GRCm39) I287V probably damaging Het
Mrpl47 A G 3: 32,784,233 (GRCm39) V179A probably benign Het
Mtcl1 T C 17: 66,687,178 (GRCm39) K576R probably damaging Het
Myh10 C A 11: 68,703,884 (GRCm39) A1902E probably damaging Het
Nlrp3 A G 11: 59,449,228 (GRCm39) T837A possibly damaging Het
Nr1i3 T C 1: 171,044,963 (GRCm39) Y132H probably damaging Het
Oit3 T C 10: 59,263,762 (GRCm39) probably null Het
Or12j4 A T 7: 140,046,773 (GRCm39) I220F probably damaging Het
Or2z2 A T 11: 58,346,088 (GRCm39) M229K probably damaging Het
Or4c100 A T 2: 88,356,159 (GRCm39) R77S probably damaging Het
Or5b113 T C 19: 13,342,717 (GRCm39) S242P probably damaging Het
Or5h25 T A 16: 58,930,944 (GRCm39) I10F probably benign Het
Or6k14 A G 1: 173,927,599 (GRCm39) T192A probably benign Het
Or7a42 T A 10: 78,791,531 (GRCm39) V164E probably damaging Het
Or9k2 G A 10: 129,999,033 (GRCm39) T54I probably benign Het
Pdlim4 T C 11: 53,946,699 (GRCm39) E196G possibly damaging Het
Pigs A G 11: 78,228,673 (GRCm39) Y293C probably damaging Het
Pkd1l2 A T 8: 117,757,458 (GRCm39) S1527T possibly damaging Het
Pkd2l1 A T 19: 44,144,040 (GRCm39) Y344* probably null Het
Pmp2 T C 3: 10,247,284 (GRCm39) probably null Het
Polr3e T C 7: 120,538,521 (GRCm39) probably null Het
Ppp3ca C G 3: 136,587,209 (GRCm39) I230M probably benign Het
Ppp5c T C 7: 16,739,235 (GRCm39) H463R probably benign Het
Ptger1 A G 8: 84,395,926 (GRCm39) N328D probably benign Het
Rhno1 A T 6: 128,334,822 (GRCm39) I167N probably benign Het
Rictor C A 15: 6,764,849 (GRCm39) P34H probably damaging Het
Rnf168 A G 16: 32,117,942 (GRCm39) Q501R probably benign Het
Rngtt T G 4: 33,329,634 (GRCm39) probably null Het
Samd9l G T 6: 3,373,126 (GRCm39) F1378L probably damaging Het
Slc9c1 T A 16: 45,409,872 (GRCm39) M864K probably benign Het
Slitrk5 T C 14: 111,917,951 (GRCm39) F525S probably damaging Het
Sox6 T C 7: 115,076,290 (GRCm39) M784V probably benign Het
Spata31e4 A T 13: 50,855,123 (GRCm39) T254S probably damaging Het
Spint2 C T 7: 28,959,791 (GRCm39) probably null Het
Ssh1 A T 5: 114,093,906 (GRCm39) I276N probably damaging Het
Trank1 T A 9: 111,221,939 (GRCm39) V2892D probably benign Het
Ttn C A 2: 76,581,384 (GRCm39) E21424* probably null Het
Usp17lc T C 7: 103,068,055 (GRCm39) I450T probably benign Het
Vcan A G 13: 89,852,854 (GRCm39) V702A probably benign Het
Vmn1r36 TA TAA 6: 66,693,517 (GRCm39) probably null Het
Vmn2r51 G T 7: 9,833,873 (GRCm39) D388E probably benign Het
Zfp106 A C 2: 120,364,245 (GRCm39) S721A probably damaging Het
Zfp106 G A 2: 120,364,244 (GRCm39) S721L probably damaging Het
Zfp189 T A 4: 49,529,342 (GRCm39) H148Q possibly damaging Het
Zfp352 A T 4: 90,112,046 (GRCm39) Y62F probably benign Het
Zfp839 T C 12: 110,821,891 (GRCm39) V235A probably damaging Het
Zfp871 T C 17: 32,994,308 (GRCm39) Y289C probably damaging Het
Other mutations in Rnf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Rnf10 APN 5 115,395,042 (GRCm39) missense probably damaging 1.00
IGL01995:Rnf10 APN 5 115,389,161 (GRCm39) nonsense probably null
IGL02291:Rnf10 APN 5 115,398,255 (GRCm39) missense probably damaging 1.00
IGL02751:Rnf10 APN 5 115,380,725 (GRCm39) missense probably benign 0.20
IGL02897:Rnf10 APN 5 115,386,700 (GRCm39) missense probably benign
IGL02968:Rnf10 APN 5 115,383,947 (GRCm39) missense probably benign 0.05
IGL03008:Rnf10 APN 5 115,389,355 (GRCm39) missense possibly damaging 0.92
IGL03098:Rnf10 UTSW 5 115,410,426 (GRCm39) missense probably damaging 1.00
R0409:Rnf10 UTSW 5 115,393,506 (GRCm39) splice site probably benign
R1083:Rnf10 UTSW 5 115,398,163 (GRCm39) splice site probably benign
R1957:Rnf10 UTSW 5 115,398,381 (GRCm39) splice site probably benign
R2398:Rnf10 UTSW 5 115,385,332 (GRCm39) missense probably benign 0.33
R2848:Rnf10 UTSW 5 115,387,171 (GRCm39) missense probably benign
R2849:Rnf10 UTSW 5 115,387,171 (GRCm39) missense probably benign
R4527:Rnf10 UTSW 5 115,398,210 (GRCm39) missense probably damaging 0.96
R4617:Rnf10 UTSW 5 115,386,762 (GRCm39) missense probably damaging 1.00
R4673:Rnf10 UTSW 5 115,389,148 (GRCm39) missense probably damaging 0.99
R4823:Rnf10 UTSW 5 115,393,501 (GRCm39) critical splice acceptor site probably null
R5560:Rnf10 UTSW 5 115,388,057 (GRCm39) missense probably damaging 1.00
R5805:Rnf10 UTSW 5 115,382,127 (GRCm39) missense probably benign
R6192:Rnf10 UTSW 5 115,395,136 (GRCm39) missense probably damaging 1.00
R7061:Rnf10 UTSW 5 115,395,149 (GRCm39) missense probably damaging 0.98
R7206:Rnf10 UTSW 5 115,382,180 (GRCm39) missense probably benign 0.04
R7213:Rnf10 UTSW 5 115,380,533 (GRCm39) missense probably damaging 1.00
R7213:Rnf10 UTSW 5 115,380,532 (GRCm39) missense probably damaging 1.00
R7429:Rnf10 UTSW 5 115,386,739 (GRCm39) missense probably damaging 1.00
R8098:Rnf10 UTSW 5 115,389,438 (GRCm39) missense probably damaging 0.98
R8179:Rnf10 UTSW 5 115,398,176 (GRCm39) frame shift probably null
R8252:Rnf10 UTSW 5 115,398,373 (GRCm39) missense probably benign 0.03
R8357:Rnf10 UTSW 5 115,410,320 (GRCm39) missense possibly damaging 0.54
R8457:Rnf10 UTSW 5 115,410,320 (GRCm39) missense possibly damaging 0.54
R9160:Rnf10 UTSW 5 115,398,249 (GRCm39) missense probably benign 0.06
R9274:Rnf10 UTSW 5 115,385,322 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAATGTGCCAGGTTGGTTAGAGC -3'
(R):5'- ATTTGTCTCCCAGGCCCTTAGAGC -3'

Sequencing Primer
(F):5'- tcccagcatccattaactcc -3'
(R):5'- TAGAGCAGCTCTGACCAGC -3'
Posted On 2014-05-23