Mutagenetix > Incidental Mutation

Incidental Mutation 'R1754:Samd9l'

193830

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

039786-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1754 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 3373126 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1378 (F1378L)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000120087
AA Change: F1378L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: F1378L

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563D23Rik	A	G	16: 92,321,031	V123A	probably damaging	Het
Abca2	T	A	2: 25,434,333	L234M	probably benign	Het
Abca3	G	A	17: 24,377,779	S402N	probably benign	Het
Acad12	A	T	5: 121,607,481	V249D	probably benign	Het
Acp4	T	C	7: 44,255,004	I212V	probably benign	Het
Actl6a	T	A	3: 32,718,574	V233D	probably damaging	Het
Aire	T	A	10: 78,030,290	Q533L	probably damaging	Het
Aldh3b3	T	C	19: 3,968,517	S411P	probably benign	Het
Amer2	A	G	14: 60,379,757	K467R	probably damaging	Het
Apol9b	A	T	15: 77,735,762	I253F	probably benign	Het
Arid1b	A	G	17: 5,279,201		probably null	Het
Atp6v0a4	T	C	6: 38,067,829	T494A	probably benign	Het
Atp6v1b2	A	G	8: 69,101,961	D106G	probably benign	Het
Avpr1b	T	C	1: 131,600,101	S121P	probably damaging	Het
Bcl11a	A	C	11: 24,164,724	E689A	probably damaging	Het
Brpf3	T	G	17: 28,821,323	L906R	probably benign	Het
Btn1a1	T	C	13: 23,460,468	K287E	probably benign	Het
Cacna1i	A	G	15: 80,371,529	H871R	probably damaging	Het
Cd14	A	T	18: 36,725,514	L296Q	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Colgalt1	G	T	8: 71,623,179	W490L	probably damaging	Het
Ctnna2	A	G	6: 77,636,749	I273T	possibly damaging	Het
Dnah7a	A	T	1: 53,504,185	D2275E	probably benign	Het
Dnah7a	A	C	1: 53,561,900		probably null	Het
Egfem1	T	C	3: 29,668,333	Y404H	possibly damaging	Het
Esm1	A	T	13: 113,216,696	N171Y	probably damaging	Het
Exoc1	T	G	5: 76,560,322		probably null	Het
Fcho1	A	G	8: 71,711,246	I580T	probably benign	Het
Fgfr1	A	G	8: 25,570,210	H552R	probably damaging	Het
Fsbp	A	G	4: 11,583,906	R202G	probably damaging	Het
Gabra6	A	G	11: 42,316,561	V231A	probably damaging	Het
Gm8765	A	T	13: 50,701,087	T254S	probably damaging	Het
Gmeb1	A	G	4: 132,232,027	S239P	probably benign	Het
Gnpat	T	A	8: 124,877,006	Y208N	probably damaging	Het
Il21	T	C	3: 37,225,525	K114R	possibly damaging	Het
Inhbc	T	C	10: 127,370,293	D35G	possibly damaging	Het
Inpp4b	A	T	8: 81,770,811	T87S	probably damaging	Het
Kcns2	T	C	15: 34,839,517	I342T	possibly damaging	Het
Ky	A	T	9: 102,541,927	T378S	possibly damaging	Het
Lcat	CAT	C	8: 105,941,814		probably null	Het
Lrrc8d	T	C	5: 105,812,657	V311A	probably benign	Het
Mief1	A	G	15: 80,249,602	I287V	probably damaging	Het
Mrpl47	A	G	3: 32,730,084	V179A	probably benign	Het
Mtcl1	T	C	17: 66,380,183	K576R	probably damaging	Het
Myh10	C	A	11: 68,813,058	A1902E	probably damaging	Het
Nlrp3	A	G	11: 59,558,402	T837A	possibly damaging	Het
Nr1i3	T	C	1: 171,217,394	Y132H	probably damaging	Het
Oit3	T	C	10: 59,427,940		probably null	Het
Olfr1186	A	T	2: 88,525,815	R77S	probably damaging	Het
Olfr1467	T	C	19: 13,365,353	S242P	probably damaging	Het
Olfr193	T	A	16: 59,110,581	I10F	probably benign	Het
Olfr30	A	T	11: 58,455,262	M229K	probably damaging	Het
Olfr427	A	G	1: 174,100,033	T192A	probably benign	Het
Olfr533	A	T	7: 140,466,860	I220F	probably damaging	Het
Olfr8	T	A	10: 78,955,697	V164E	probably damaging	Het
Olfr825	G	A	10: 130,163,164	T54I	probably benign	Het
Pdlim4	T	C	11: 54,055,873	E196G	possibly damaging	Het
Pigs	A	G	11: 78,337,847	Y293C	probably damaging	Het
Pkd1l2	A	T	8: 117,030,719	S1527T	possibly damaging	Het
Pkd2l1	A	T	19: 44,155,601	Y344*	probably null	Het
Pmp2	T	C	3: 10,182,224		probably null	Het
Polr3e	T	C	7: 120,939,298		probably null	Het
Ppp3ca	C	G	3: 136,881,448	I230M	probably benign	Het
Ppp5c	T	C	7: 17,005,310	H463R	probably benign	Het
Ptger1	A	G	8: 83,669,297	N328D	probably benign	Het
Rhno1	A	T	6: 128,357,859	I167N	probably benign	Het
Rictor	C	A	15: 6,735,368	P34H	probably damaging	Het
Rnf10	A	C	5: 115,245,865	S630R	probably damaging	Het
Rnf168	A	G	16: 32,299,124	Q501R	probably benign	Het
Rngtt	T	G	4: 33,329,634		probably null	Het
Slc9c1	T	A	16: 45,589,509	M864K	probably benign	Het
Slitrk5	T	C	14: 111,680,519	F525S	probably damaging	Het
Sox6	T	C	7: 115,477,055	M784V	probably benign	Het
Spint2	C	T	7: 29,260,366		probably null	Het
Ssh1	A	T	5: 113,955,845	I276N	probably damaging	Het
Trank1	T	A	9: 111,392,871	V2892D	probably benign	Het
Ttn	C	A	2: 76,751,040	E21424*	probably null	Het
Usp17lc	T	C	7: 103,418,848	I450T	probably benign	Het
Vcan	A	G	13: 89,704,735	V702A	probably benign	Het
Vmn1r36	TA	TAA	6: 66,716,533		probably null	Het
Vmn2r51	G	T	7: 10,099,946	D388E	probably benign	Het
Zfp106	G	A	2: 120,533,763	S721L	probably damaging	Het
Zfp106	A	C	2: 120,533,764	S721A	probably damaging	Het
Zfp189	T	A	4: 49,529,342	H148Q	possibly damaging	Het
Zfp352	A	T	4: 90,223,809	Y62F	probably benign	Het
Zfp839	T	C	12: 110,855,457	V235A	probably damaging	Het
Zfp871	T	C	17: 32,775,334	Y289C	probably damaging	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3375854	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGCTCGATTTCAGCCTTATGAAC -3'
(R):5'- TGGCGAGCAGATACATTTTCAGGAC -3'

Sequencing Primer
(F):5'- GTACTGTCTCCTGAAGGATCG -3'
(R):5'- TCAGGACTCCTTGAATATCTTAATCC -3'

Posted On

2014-05-23