Incidental Mutation 'R1754:Inpp4b'
ID 193849
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Name inositol polyphosphate-4-phosphatase, type II
Synonyms E130107I17Rik
MMRRC Submission 039786-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R1754 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 82069185-82854543 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 82497440 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 87 (T87S)
Ref Sequence ENSEMBL: ENSMUSP00000148972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000215332] [ENSMUST00000217122]
AlphaFold Q6P1Y8
Predicted Effect possibly damaging
Transcript: ENSMUST00000042529
AA Change: T87S

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: T87S

DomainStartEndE-ValueType
C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109852
AA Change: T87S

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: T87S

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164870
Predicted Effect possibly damaging
Transcript: ENSMUST00000169116
AA Change: T87S

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: T87S

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169387
AA Change: N47I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000170160
SMART Domains Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
low complexity region 257 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172031
AA Change: T87S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: T87S

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000213285
AA Change: T87S

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000215332
AA Change: T87S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217122
AA Change: T87S

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216036
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,324,345 (GRCm39) L234M probably benign Het
Abca3 G A 17: 24,596,753 (GRCm39) S402N probably benign Het
Acad12 A T 5: 121,745,544 (GRCm39) V249D probably benign Het
Acp4 T C 7: 43,904,428 (GRCm39) I212V probably benign Het
Actl6a T A 3: 32,772,723 (GRCm39) V233D probably damaging Het
Aire T A 10: 77,866,124 (GRCm39) Q533L probably damaging Het
Aldh3b3 T C 19: 4,018,517 (GRCm39) S411P probably benign Het
Amer2 A G 14: 60,617,206 (GRCm39) K467R probably damaging Het
Apol9b A T 15: 77,619,962 (GRCm39) I253F probably benign Het
Arid1b A G 17: 5,329,476 (GRCm39) probably null Het
Atp6v0a4 T C 6: 38,044,764 (GRCm39) T494A probably benign Het
Atp6v1b2 A G 8: 69,554,613 (GRCm39) D106G probably benign Het
Avpr1b T C 1: 131,527,839 (GRCm39) S121P probably damaging Het
Bcl11a A C 11: 24,114,724 (GRCm39) E689A probably damaging Het
Brpf3 T G 17: 29,040,297 (GRCm39) L906R probably benign Het
Btn1a1 T C 13: 23,644,638 (GRCm39) K287E probably benign Het
Cacna1i A G 15: 80,255,730 (GRCm39) H871R probably damaging Het
Cd14 A T 18: 36,858,567 (GRCm39) L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Colgalt1 G T 8: 72,075,823 (GRCm39) W490L probably damaging Het
Ctnna2 A G 6: 77,613,732 (GRCm39) I273T possibly damaging Het
Dnah7a A T 1: 53,543,344 (GRCm39) D2275E probably benign Het
Dnah7a A C 1: 53,601,059 (GRCm39) probably null Het
Egfem1 T C 3: 29,722,482 (GRCm39) Y404H possibly damaging Het
Esm1 A T 13: 113,353,230 (GRCm39) N171Y probably damaging Het
Exoc1 T G 5: 76,708,169 (GRCm39) probably null Het
Fam243 A G 16: 92,117,919 (GRCm39) V123A probably damaging Het
Fcho1 A G 8: 72,163,890 (GRCm39) I580T probably benign Het
Fgfr1 A G 8: 26,060,226 (GRCm39) H552R probably damaging Het
Fsbp A G 4: 11,583,906 (GRCm39) R202G probably damaging Het
Gabra6 A G 11: 42,207,388 (GRCm39) V231A probably damaging Het
Gmeb1 A G 4: 131,959,338 (GRCm39) S239P probably benign Het
Gnpat T A 8: 125,603,745 (GRCm39) Y208N probably damaging Het
Il21 T C 3: 37,279,674 (GRCm39) K114R possibly damaging Het
Inhbc T C 10: 127,206,162 (GRCm39) D35G possibly damaging Het
Kcns2 T C 15: 34,839,663 (GRCm39) I342T possibly damaging Het
Ky A T 9: 102,419,126 (GRCm39) T378S possibly damaging Het
Lcat CAT C 8: 106,668,446 (GRCm39) probably null Het
Lrrc8d T C 5: 105,960,523 (GRCm39) V311A probably benign Het
Mief1 A G 15: 80,133,803 (GRCm39) I287V probably damaging Het
Mrpl47 A G 3: 32,784,233 (GRCm39) V179A probably benign Het
Mtcl1 T C 17: 66,687,178 (GRCm39) K576R probably damaging Het
Myh10 C A 11: 68,703,884 (GRCm39) A1902E probably damaging Het
Nlrp3 A G 11: 59,449,228 (GRCm39) T837A possibly damaging Het
Nr1i3 T C 1: 171,044,963 (GRCm39) Y132H probably damaging Het
Oit3 T C 10: 59,263,762 (GRCm39) probably null Het
Or12j4 A T 7: 140,046,773 (GRCm39) I220F probably damaging Het
Or2z2 A T 11: 58,346,088 (GRCm39) M229K probably damaging Het
Or4c100 A T 2: 88,356,159 (GRCm39) R77S probably damaging Het
Or5b113 T C 19: 13,342,717 (GRCm39) S242P probably damaging Het
Or5h25 T A 16: 58,930,944 (GRCm39) I10F probably benign Het
Or6k14 A G 1: 173,927,599 (GRCm39) T192A probably benign Het
Or7a42 T A 10: 78,791,531 (GRCm39) V164E probably damaging Het
Or9k2 G A 10: 129,999,033 (GRCm39) T54I probably benign Het
Pdlim4 T C 11: 53,946,699 (GRCm39) E196G possibly damaging Het
Pigs A G 11: 78,228,673 (GRCm39) Y293C probably damaging Het
Pkd1l2 A T 8: 117,757,458 (GRCm39) S1527T possibly damaging Het
Pkd2l1 A T 19: 44,144,040 (GRCm39) Y344* probably null Het
Pmp2 T C 3: 10,247,284 (GRCm39) probably null Het
Polr3e T C 7: 120,538,521 (GRCm39) probably null Het
Ppp3ca C G 3: 136,587,209 (GRCm39) I230M probably benign Het
Ppp5c T C 7: 16,739,235 (GRCm39) H463R probably benign Het
Ptger1 A G 8: 84,395,926 (GRCm39) N328D probably benign Het
Rhno1 A T 6: 128,334,822 (GRCm39) I167N probably benign Het
Rictor C A 15: 6,764,849 (GRCm39) P34H probably damaging Het
Rnf10 A C 5: 115,383,924 (GRCm39) S630R probably damaging Het
Rnf168 A G 16: 32,117,942 (GRCm39) Q501R probably benign Het
Rngtt T G 4: 33,329,634 (GRCm39) probably null Het
Samd9l G T 6: 3,373,126 (GRCm39) F1378L probably damaging Het
Slc9c1 T A 16: 45,409,872 (GRCm39) M864K probably benign Het
Slitrk5 T C 14: 111,917,951 (GRCm39) F525S probably damaging Het
Sox6 T C 7: 115,076,290 (GRCm39) M784V probably benign Het
Spata31e4 A T 13: 50,855,123 (GRCm39) T254S probably damaging Het
Spint2 C T 7: 28,959,791 (GRCm39) probably null Het
Ssh1 A T 5: 114,093,906 (GRCm39) I276N probably damaging Het
Trank1 T A 9: 111,221,939 (GRCm39) V2892D probably benign Het
Ttn C A 2: 76,581,384 (GRCm39) E21424* probably null Het
Usp17lc T C 7: 103,068,055 (GRCm39) I450T probably benign Het
Vcan A G 13: 89,852,854 (GRCm39) V702A probably benign Het
Vmn1r36 TA TAA 6: 66,693,517 (GRCm39) probably null Het
Vmn2r51 G T 7: 9,833,873 (GRCm39) D388E probably benign Het
Zfp106 A C 2: 120,364,245 (GRCm39) S721A probably damaging Het
Zfp106 G A 2: 120,364,244 (GRCm39) S721L probably damaging Het
Zfp189 T A 4: 49,529,342 (GRCm39) H148Q possibly damaging Het
Zfp352 A T 4: 90,112,046 (GRCm39) Y62F probably benign Het
Zfp839 T C 12: 110,821,891 (GRCm39) V235A probably damaging Het
Zfp871 T C 17: 32,994,308 (GRCm39) Y289C probably damaging Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 82,583,379 (GRCm39) missense probably damaging 1.00
IGL01481:Inpp4b APN 8 82,724,009 (GRCm39) missense probably damaging 1.00
IGL01509:Inpp4b APN 8 82,617,332 (GRCm39) splice site probably benign
IGL01515:Inpp4b APN 8 82,679,340 (GRCm39) missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82,737,292 (GRCm39) missense probably benign 0.03
IGL01643:Inpp4b APN 8 82,798,400 (GRCm39) missense probably damaging 0.97
IGL01736:Inpp4b APN 8 82,723,968 (GRCm39) missense probably benign 0.00
IGL02154:Inpp4b APN 8 82,696,130 (GRCm39) splice site probably benign
IGL02327:Inpp4b APN 8 82,768,591 (GRCm39) missense probably benign 0.01
IGL02413:Inpp4b APN 8 82,759,800 (GRCm39) missense probably benign
IGL02652:Inpp4b APN 8 82,497,429 (GRCm39) splice site probably benign
IGL02678:Inpp4b APN 8 82,583,373 (GRCm39) missense probably damaging 1.00
IGL03146:Inpp4b APN 8 82,470,410 (GRCm39) missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 82,419,639 (GRCm39) intron probably benign
PIT4280001:Inpp4b UTSW 8 82,761,046 (GRCm39) missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82,772,896 (GRCm39) missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82,768,564 (GRCm39) missense probably damaging 1.00
R0083:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 82,497,546 (GRCm39) missense probably benign 0.00
R0285:Inpp4b UTSW 8 82,761,145 (GRCm39) splice site probably benign
R0363:Inpp4b UTSW 8 82,610,886 (GRCm39) splice site probably benign
R0364:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R0471:Inpp4b UTSW 8 82,768,528 (GRCm39) missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 82,723,966 (GRCm39) missense probably benign 0.00
R0562:Inpp4b UTSW 8 82,494,780 (GRCm39) missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R1081:Inpp4b UTSW 8 82,795,653 (GRCm39) missense probably damaging 0.97
R1251:Inpp4b UTSW 8 82,617,382 (GRCm39) missense probably benign 0.01
R1374:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably null
R1445:Inpp4b UTSW 8 82,679,463 (GRCm39) splice site probably null
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1647:Inpp4b UTSW 8 82,583,403 (GRCm39) splice site probably benign
R1759:Inpp4b UTSW 8 82,494,732 (GRCm39) missense probably benign 0.06
R2085:Inpp4b UTSW 8 82,678,903 (GRCm39) missense probably damaging 1.00
R2156:Inpp4b UTSW 8 82,775,118 (GRCm39) missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82,848,004 (GRCm39) nonsense probably null
R2175:Inpp4b UTSW 8 82,583,328 (GRCm39) missense probably damaging 1.00
R2191:Inpp4b UTSW 8 82,723,931 (GRCm39) missense probably damaging 1.00
R2401:Inpp4b UTSW 8 82,723,968 (GRCm39) missense probably benign 0.00
R2475:Inpp4b UTSW 8 82,768,607 (GRCm39) missense probably benign 0.09
R2512:Inpp4b UTSW 8 82,737,179 (GRCm39) missense probably damaging 1.00
R2919:Inpp4b UTSW 8 82,711,958 (GRCm39) missense possibly damaging 0.93
R3021:Inpp4b UTSW 8 82,629,467 (GRCm39) missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 82,678,890 (GRCm39) missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3778:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R4590:Inpp4b UTSW 8 82,468,040 (GRCm39) start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 82,696,164 (GRCm39) missense probably damaging 0.99
R4691:Inpp4b UTSW 8 82,849,282 (GRCm39) missense probably damaging 1.00
R4924:Inpp4b UTSW 8 82,849,253 (GRCm39) missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82,759,837 (GRCm39) missense probably damaging 1.00
R5219:Inpp4b UTSW 8 82,610,785 (GRCm39) missense probably benign 0.01
R5228:Inpp4b UTSW 8 82,494,744 (GRCm39) missense probably damaging 0.99
R5557:Inpp4b UTSW 8 82,678,888 (GRCm39) missense probably damaging 0.99
R5627:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably benign
R5691:Inpp4b UTSW 8 82,617,323 (GRCm39) intron probably benign
R6186:Inpp4b UTSW 8 82,772,863 (GRCm39) missense probably damaging 0.99
R6213:Inpp4b UTSW 8 82,724,019 (GRCm39) missense probably damaging 1.00
R6232:Inpp4b UTSW 8 82,678,813 (GRCm39) missense probably damaging 1.00
R6283:Inpp4b UTSW 8 82,497,462 (GRCm39) missense probably damaging 1.00
R6302:Inpp4b UTSW 8 82,494,806 (GRCm39) missense probably benign 0.00
R6309:Inpp4b UTSW 8 82,768,546 (GRCm39) missense probably damaging 1.00
R6360:Inpp4b UTSW 8 82,629,481 (GRCm39) missense probably benign 0.20
R6477:Inpp4b UTSW 8 82,571,343 (GRCm39) splice site probably null
R6773:Inpp4b UTSW 8 82,583,249 (GRCm39) intron probably benign
R6968:Inpp4b UTSW 8 82,571,086 (GRCm39) missense probably benign 0.18
R7147:Inpp4b UTSW 8 82,629,400 (GRCm39) missense probably damaging 1.00
R7318:Inpp4b UTSW 8 82,798,374 (GRCm39) missense probably damaging 1.00
R7409:Inpp4b UTSW 8 82,679,314 (GRCm39) splice site probably null
R7455:Inpp4b UTSW 8 82,798,332 (GRCm39) missense probably damaging 0.99
R7632:Inpp4b UTSW 8 82,772,968 (GRCm39) missense probably damaging 1.00
R7844:Inpp4b UTSW 8 82,467,949 (GRCm39) start gained probably benign
R7958:Inpp4b UTSW 8 82,696,218 (GRCm39) missense probably damaging 1.00
R8440:Inpp4b UTSW 8 82,768,524 (GRCm39) missense probably damaging 1.00
R9160:Inpp4b UTSW 8 82,610,782 (GRCm39) missense possibly damaging 0.55
R9303:Inpp4b UTSW 8 82,759,758 (GRCm39) missense probably damaging 1.00
R9390:Inpp4b UTSW 8 82,497,522 (GRCm39) missense probably damaging 1.00
R9583:Inpp4b UTSW 8 82,497,555 (GRCm39) critical splice donor site probably null
R9705:Inpp4b UTSW 8 82,772,890 (GRCm39) missense probably benign 0.14
R9778:Inpp4b UTSW 8 82,775,160 (GRCm39) missense probably benign
RF003:Inpp4b UTSW 8 82,696,150 (GRCm39) nonsense probably null
Z1088:Inpp4b UTSW 8 82,795,560 (GRCm39) critical splice acceptor site probably null
Z1176:Inpp4b UTSW 8 82,795,630 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AGCAATCACACGCATAGAGGATAGC -3'
(R):5'- CCACAGCTTGGCAAAGTATGACGAC -3'

Sequencing Primer
(F):5'- GGGttttgtttgtttgtttgtttttg -3'
(R):5'- TTGGCAAAGTATGACGACCTCTC -3'
Posted On 2014-05-23