Incidental Mutation 'R1754:Ptger1'
ID193850
Institutional Source Beutler Lab
Gene Symbol Ptger1
Ensembl Gene ENSMUSG00000019464
Gene Nameprostaglandin E receptor 1 (subtype EP1)
SynonymsEP1, 42kDa, Ptgerep1
MMRRC Submission 039786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1754 (G1)
Quality Score123
Status Not validated
Chromosome8
Chromosomal Location83666678-83672753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83669297 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 328 (N328D)
Ref Sequence ENSEMBL: ENSMUSP00000019608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005616] [ENSMUST00000019577] [ENSMUST00000019608] [ENSMUST00000132945] [ENSMUST00000144258]
Predicted Effect probably benign
Transcript: ENSMUST00000005616
SMART Domains Protein: ENSMUSP00000005616
Gene: ENSMUSG00000057672

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Hr1 37 101 6.74e-20 SMART
Hr1 126 194 1.13e-21 SMART
Hr1 216 284 7.79e-25 SMART
C2 328 464 2.45e-1 SMART
low complexity region 569 601 N/A INTRINSIC
S_TKc 619 878 2.83e-96 SMART
S_TK_X 879 943 5.29e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019577
SMART Domains Protein: ENSMUSP00000019577
Gene: ENSMUSG00000019433

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
PDZ 141 215 9.07e-13 SMART
low complexity region 236 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019608
AA Change: N328D

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019608
Gene: ENSMUSG00000019464
AA Change: N328D

DomainStartEndE-ValueType
Pfam:7tm_1 52 354 2.3e-17 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 392 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128523
Predicted Effect probably benign
Transcript: ENSMUST00000132945
SMART Domains Protein: ENSMUSP00000115054
Gene: ENSMUSG00000057672

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Hr1 49 113 6.74e-20 SMART
Hr1 138 206 1.13e-21 SMART
Hr1 228 296 7.79e-25 SMART
C2 340 476 2.45e-1 SMART
low complexity region 581 613 N/A INTRINSIC
Pfam:Pkinase 631 756 2.2e-23 PFAM
Pfam:Pkinase_Tyr 631 757 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138898
Predicted Effect probably benign
Transcript: ENSMUST00000144258
SMART Domains Protein: ENSMUSP00000116235
Gene: ENSMUSG00000057672

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Hr1 42 106 6.74e-20 SMART
Hr1 131 199 1.13e-21 SMART
Hr1 221 289 7.79e-25 SMART
C2 333 469 2.45e-1 SMART
low complexity region 574 606 N/A INTRINSIC
S_TKc 624 883 2.83e-96 SMART
S_TK_X 884 948 5.29e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212519
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G protein-coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). Through a phosphatidylinositol-calcium second messenger system, G-Q proteins mediate this receptor's activity. Knockout studies in mice suggested a role of this receptor in mediating algesia and in regulation of blood pressure. Studies in mice also suggested that this gene may mediate adrenocorticotropic hormone response to bacterial endotoxin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may exhibit partial prenatal lethality, pain threshold abnormalities, behavioral disinhibition in response to stress, low blood pressure, defects in type IV hypersensitivity reactions, resistance to chemically induced tumors and impaired response to water deprivation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca2 T A 2: 25,434,333 L234M probably benign Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Acp4 T C 7: 44,255,004 I212V probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Arid1b A G 17: 5,279,201 probably null Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Dnah7a A C 1: 53,561,900 probably null Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gmeb1 A G 4: 132,232,027 S239P probably benign Het
Gnpat T A 8: 124,877,006 Y208N probably damaging Het
Il21 T C 3: 37,225,525 K114R possibly damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Myh10 C A 11: 68,813,058 A1902E probably damaging Het
Nlrp3 A G 11: 59,558,402 T837A possibly damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf10 A C 5: 115,245,865 S630R probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Ssh1 A T 5: 113,955,845 I276N probably damaging Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Ptger1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01975:Ptger1 APN 8 83669520 unclassified probably benign
IGL02069:Ptger1 APN 8 83669457 missense probably benign
R0042:Ptger1 UTSW 8 83668166 missense probably benign 0.31
R0069:Ptger1 UTSW 8 83668319 missense possibly damaging 0.91
R1694:Ptger1 UTSW 8 83668478 missense probably benign 0.01
R1858:Ptger1 UTSW 8 83668478 missense probably benign 0.02
R1973:Ptger1 UTSW 8 83669454 missense probably benign 0.13
R2217:Ptger1 UTSW 8 83668728 missense probably benign 0.03
R5276:Ptger1 UTSW 8 83669345 missense possibly damaging 0.56
R5569:Ptger1 UTSW 8 83668332 unclassified probably null
R6822:Ptger1 UTSW 8 83668650 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTCCCAGCTTGTTGACCTTAGAG -3'
(R):5'- AACTACGCAGTGAACTGGCTTCC -3'

Sequencing Primer
(F):5'- GTAATACTGGGTCTTCTCTAGCCG -3'
(R):5'- AACTGGCTTCCCAGGCAC -3'
Posted On2014-05-23