Incidental Mutation 'R1754:Gnpat'
ID193853
Institutional Source Beutler Lab
Gene Symbol Gnpat
Ensembl Gene ENSMUSG00000031985
Gene Nameglyceronephosphate O-acyltransferase
SynonymsD1Ertd819e
MMRRC Submission 039786-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R1754 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124863033-124890057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124877006 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 208 (Y208N)
Ref Sequence ENSEMBL: ENSMUSP00000125323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034466] [ENSMUST00000161986]
Predicted Effect probably damaging
Transcript: ENSMUST00000034466
AA Change: Y218N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034466
Gene: ENSMUSG00000031985
AA Change: Y218N

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
SCOP:d1dbha1 27 146 6e-3 SMART
PlsC 155 284 8.3e-21 SMART
Blast:PlsC 308 336 1e-6 BLAST
low complexity region 638 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161986
AA Change: Y208N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125323
Gene: ENSMUSG00000031985
AA Change: Y208N

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
PlsC 145 274 8.3e-21 SMART
Blast:PlsC 298 326 2e-6 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme located in the peroxisomal membrane which is essential to the synthesis of ether phospholipids. Mutations in this gene are associated with rhizomelic chondrodysplasia punctata. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice lack plasmalogens due to inactivation of ether lipid synthesis. Mutant mice exhibit dwarfism, male infertility, defects in eye development, and optic nerve hypoplasia. While some mice die prematurely, others, particularly females, are long-lived. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca2 T A 2: 25,434,333 L234M probably benign Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Acp4 T C 7: 44,255,004 I212V probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Arid1b A G 17: 5,279,201 probably null Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Dnah7a A C 1: 53,561,900 probably null Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gmeb1 A G 4: 132,232,027 S239P probably benign Het
Il21 T C 3: 37,225,525 K114R possibly damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Myh10 C A 11: 68,813,058 A1902E probably damaging Het
Nlrp3 A G 11: 59,558,402 T837A possibly damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Ptger1 A G 8: 83,669,297 N328D probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf10 A C 5: 115,245,865 S630R probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Ssh1 A T 5: 113,955,845 I276N probably damaging Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Gnpat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Gnpat APN 8 124876914 splice site probably benign
IGL00422:Gnpat APN 8 124885013 missense probably damaging 1.00
IGL01327:Gnpat APN 8 124878633 missense probably damaging 1.00
IGL02257:Gnpat APN 8 124886848 unclassified probably benign
IGL02951:Gnpat APN 8 124870905 missense probably benign 0.01
IGL03084:Gnpat APN 8 124878899 missense probably damaging 0.99
R0114:Gnpat UTSW 8 124883357 missense probably benign 0.06
R0394:Gnpat UTSW 8 124880225 missense possibly damaging 0.82
R1023:Gnpat UTSW 8 124870780 missense probably benign 0.28
R1052:Gnpat UTSW 8 124877507 missense probably benign 0.00
R1052:Gnpat UTSW 8 124878516 missense probably damaging 1.00
R1537:Gnpat UTSW 8 124870816 missense probably damaging 0.97
R1604:Gnpat UTSW 8 124876961 missense probably damaging 1.00
R1711:Gnpat UTSW 8 124886952 splice site probably null
R2118:Gnpat UTSW 8 124876941 missense probably damaging 0.99
R2278:Gnpat UTSW 8 124876920 missense probably benign 0.35
R2429:Gnpat UTSW 8 124877019 missense probably damaging 1.00
R4579:Gnpat UTSW 8 124878502 splice site probably null
R6176:Gnpat UTSW 8 124878854 missense probably damaging 1.00
R7017:Gnpat UTSW 8 124863275 missense probably benign 0.33
R7081:Gnpat UTSW 8 124863269 missense possibly damaging 0.53
R7388:Gnpat UTSW 8 124887814 missense probably benign 0.32
R7716:Gnpat UTSW 8 124876934 missense probably benign 0.32
X0025:Gnpat UTSW 8 124873399 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- TGTAAGTATTGCTGTCACAGGGCAC -3'
(R):5'- AATGGCTTCTGACCCTTAATCCAAGTG -3'

Sequencing Primer
(F):5'- TGTCACAGGGCACATGTCAC -3'
(R):5'- TAATCCAAGTGCCCCTGC -3'
Posted On2014-05-23