Incidental Mutation 'R1754:Or7a42'
ID 193860
Institutional Source Beutler Lab
Gene Symbol Or7a42
Ensembl Gene ENSMUSG00000094080
Gene Name olfactory receptor family 7 subfamily A member 42
Synonyms GA_x6K02T2QGN0-2857086-2856154, MOR139-5P, Olfr8
MMRRC Submission 039786-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R1754 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 78791041-78791973 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78791531 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 164 (V164E)
Ref Sequence ENSEMBL: ENSMUSP00000148856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081571] [ENSMUST00000203851] [ENSMUST00000214952]
AlphaFold Q60892
Predicted Effect probably damaging
Transcript: ENSMUST00000081571
AA Change: V164E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080282
Gene: ENSMUSG00000094080
AA Change: V164E

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203851
AA Change: V164E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144916
Gene: ENSMUSG00000094080
AA Change: V164E

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214952
AA Change: V164E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216819
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,324,345 (GRCm39) L234M probably benign Het
Abca3 G A 17: 24,596,753 (GRCm39) S402N probably benign Het
Acad12 A T 5: 121,745,544 (GRCm39) V249D probably benign Het
Acp4 T C 7: 43,904,428 (GRCm39) I212V probably benign Het
Actl6a T A 3: 32,772,723 (GRCm39) V233D probably damaging Het
Aire T A 10: 77,866,124 (GRCm39) Q533L probably damaging Het
Aldh3b3 T C 19: 4,018,517 (GRCm39) S411P probably benign Het
Amer2 A G 14: 60,617,206 (GRCm39) K467R probably damaging Het
Apol9b A T 15: 77,619,962 (GRCm39) I253F probably benign Het
Arid1b A G 17: 5,329,476 (GRCm39) probably null Het
Atp6v0a4 T C 6: 38,044,764 (GRCm39) T494A probably benign Het
Atp6v1b2 A G 8: 69,554,613 (GRCm39) D106G probably benign Het
Avpr1b T C 1: 131,527,839 (GRCm39) S121P probably damaging Het
Bcl11a A C 11: 24,114,724 (GRCm39) E689A probably damaging Het
Brpf3 T G 17: 29,040,297 (GRCm39) L906R probably benign Het
Btn1a1 T C 13: 23,644,638 (GRCm39) K287E probably benign Het
Cacna1i A G 15: 80,255,730 (GRCm39) H871R probably damaging Het
Cd14 A T 18: 36,858,567 (GRCm39) L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Colgalt1 G T 8: 72,075,823 (GRCm39) W490L probably damaging Het
Ctnna2 A G 6: 77,613,732 (GRCm39) I273T possibly damaging Het
Dnah7a A T 1: 53,543,344 (GRCm39) D2275E probably benign Het
Dnah7a A C 1: 53,601,059 (GRCm39) probably null Het
Egfem1 T C 3: 29,722,482 (GRCm39) Y404H possibly damaging Het
Esm1 A T 13: 113,353,230 (GRCm39) N171Y probably damaging Het
Exoc1 T G 5: 76,708,169 (GRCm39) probably null Het
Fam243 A G 16: 92,117,919 (GRCm39) V123A probably damaging Het
Fcho1 A G 8: 72,163,890 (GRCm39) I580T probably benign Het
Fgfr1 A G 8: 26,060,226 (GRCm39) H552R probably damaging Het
Fsbp A G 4: 11,583,906 (GRCm39) R202G probably damaging Het
Gabra6 A G 11: 42,207,388 (GRCm39) V231A probably damaging Het
Gmeb1 A G 4: 131,959,338 (GRCm39) S239P probably benign Het
Gnpat T A 8: 125,603,745 (GRCm39) Y208N probably damaging Het
Il21 T C 3: 37,279,674 (GRCm39) K114R possibly damaging Het
Inhbc T C 10: 127,206,162 (GRCm39) D35G possibly damaging Het
Inpp4b A T 8: 82,497,440 (GRCm39) T87S probably damaging Het
Kcns2 T C 15: 34,839,663 (GRCm39) I342T possibly damaging Het
Ky A T 9: 102,419,126 (GRCm39) T378S possibly damaging Het
Lcat CAT C 8: 106,668,446 (GRCm39) probably null Het
Lrrc8d T C 5: 105,960,523 (GRCm39) V311A probably benign Het
Mief1 A G 15: 80,133,803 (GRCm39) I287V probably damaging Het
Mrpl47 A G 3: 32,784,233 (GRCm39) V179A probably benign Het
Mtcl1 T C 17: 66,687,178 (GRCm39) K576R probably damaging Het
Myh10 C A 11: 68,703,884 (GRCm39) A1902E probably damaging Het
Nlrp3 A G 11: 59,449,228 (GRCm39) T837A possibly damaging Het
Nr1i3 T C 1: 171,044,963 (GRCm39) Y132H probably damaging Het
Oit3 T C 10: 59,263,762 (GRCm39) probably null Het
Or12j4 A T 7: 140,046,773 (GRCm39) I220F probably damaging Het
Or2z2 A T 11: 58,346,088 (GRCm39) M229K probably damaging Het
Or4c100 A T 2: 88,356,159 (GRCm39) R77S probably damaging Het
Or5b113 T C 19: 13,342,717 (GRCm39) S242P probably damaging Het
Or5h25 T A 16: 58,930,944 (GRCm39) I10F probably benign Het
Or6k14 A G 1: 173,927,599 (GRCm39) T192A probably benign Het
Or9k2 G A 10: 129,999,033 (GRCm39) T54I probably benign Het
Pdlim4 T C 11: 53,946,699 (GRCm39) E196G possibly damaging Het
Pigs A G 11: 78,228,673 (GRCm39) Y293C probably damaging Het
Pkd1l2 A T 8: 117,757,458 (GRCm39) S1527T possibly damaging Het
Pkd2l1 A T 19: 44,144,040 (GRCm39) Y344* probably null Het
Pmp2 T C 3: 10,247,284 (GRCm39) probably null Het
Polr3e T C 7: 120,538,521 (GRCm39) probably null Het
Ppp3ca C G 3: 136,587,209 (GRCm39) I230M probably benign Het
Ppp5c T C 7: 16,739,235 (GRCm39) H463R probably benign Het
Ptger1 A G 8: 84,395,926 (GRCm39) N328D probably benign Het
Rhno1 A T 6: 128,334,822 (GRCm39) I167N probably benign Het
Rictor C A 15: 6,764,849 (GRCm39) P34H probably damaging Het
Rnf10 A C 5: 115,383,924 (GRCm39) S630R probably damaging Het
Rnf168 A G 16: 32,117,942 (GRCm39) Q501R probably benign Het
Rngtt T G 4: 33,329,634 (GRCm39) probably null Het
Samd9l G T 6: 3,373,126 (GRCm39) F1378L probably damaging Het
Slc9c1 T A 16: 45,409,872 (GRCm39) M864K probably benign Het
Slitrk5 T C 14: 111,917,951 (GRCm39) F525S probably damaging Het
Sox6 T C 7: 115,076,290 (GRCm39) M784V probably benign Het
Spata31e4 A T 13: 50,855,123 (GRCm39) T254S probably damaging Het
Spint2 C T 7: 28,959,791 (GRCm39) probably null Het
Ssh1 A T 5: 114,093,906 (GRCm39) I276N probably damaging Het
Trank1 T A 9: 111,221,939 (GRCm39) V2892D probably benign Het
Ttn C A 2: 76,581,384 (GRCm39) E21424* probably null Het
Usp17lc T C 7: 103,068,055 (GRCm39) I450T probably benign Het
Vcan A G 13: 89,852,854 (GRCm39) V702A probably benign Het
Vmn1r36 TA TAA 6: 66,693,517 (GRCm39) probably null Het
Vmn2r51 G T 7: 9,833,873 (GRCm39) D388E probably benign Het
Zfp106 A C 2: 120,364,245 (GRCm39) S721A probably damaging Het
Zfp106 G A 2: 120,364,244 (GRCm39) S721L probably damaging Het
Zfp189 T A 4: 49,529,342 (GRCm39) H148Q possibly damaging Het
Zfp352 A T 4: 90,112,046 (GRCm39) Y62F probably benign Het
Zfp839 T C 12: 110,821,891 (GRCm39) V235A probably damaging Het
Zfp871 T C 17: 32,994,308 (GRCm39) Y289C probably damaging Het
Other mutations in Or7a42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Or7a42 APN 10 78,791,188 (GRCm39) missense possibly damaging 0.48
IGL01480:Or7a42 APN 10 78,791,978 (GRCm39) utr 3 prime probably benign
IGL02505:Or7a42 APN 10 78,791,767 (GRCm39) missense probably benign 0.02
IGL02543:Or7a42 APN 10 78,791,773 (GRCm39) missense probably damaging 1.00
IGL03323:Or7a42 APN 10 78,791,434 (GRCm39) missense probably benign
PIT4466001:Or7a42 UTSW 10 78,791,676 (GRCm39) missense probably benign 0.00
R1496:Or7a42 UTSW 10 78,791,682 (GRCm39) missense probably benign 0.41
R1878:Or7a42 UTSW 10 78,791,639 (GRCm39) missense possibly damaging 0.62
R2760:Or7a42 UTSW 10 78,791,876 (GRCm39) missense probably damaging 0.99
R4202:Or7a42 UTSW 10 78,791,129 (GRCm39) missense probably benign
R4206:Or7a42 UTSW 10 78,791,117 (GRCm39) missense probably benign 0.00
R4517:Or7a42 UTSW 10 78,791,877 (GRCm39) nonsense probably null
R4613:Or7a42 UTSW 10 78,791,899 (GRCm39) missense probably damaging 1.00
R4799:Or7a42 UTSW 10 78,791,931 (GRCm39) missense probably null 0.92
R4979:Or7a42 UTSW 10 78,791,766 (GRCm39) nonsense probably null
R5008:Or7a42 UTSW 10 78,791,905 (GRCm39) missense probably damaging 1.00
R5700:Or7a42 UTSW 10 78,791,318 (GRCm39) missense probably damaging 1.00
R5876:Or7a42 UTSW 10 78,791,191 (GRCm39) missense probably benign 0.15
R6439:Or7a42 UTSW 10 78,791,818 (GRCm39) missense probably damaging 1.00
R6930:Or7a42 UTSW 10 78,791,615 (GRCm39) missense possibly damaging 0.84
R7110:Or7a42 UTSW 10 78,791,284 (GRCm39) missense possibly damaging 0.83
R7405:Or7a42 UTSW 10 78,791,531 (GRCm39) missense probably benign 0.14
R7524:Or7a42 UTSW 10 78,791,325 (GRCm39) nonsense probably null
R8198:Or7a42 UTSW 10 78,791,558 (GRCm39) missense probably damaging 0.97
R9227:Or7a42 UTSW 10 78,791,929 (GRCm39) missense possibly damaging 0.92
R9230:Or7a42 UTSW 10 78,791,929 (GRCm39) missense possibly damaging 0.92
Z1176:Or7a42 UTSW 10 78,791,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGGGAACCTGCTCATCATC -3'
(R):5'- TTGGACCACAGCAGAACTGACATAC -3'

Sequencing Primer
(F):5'- GGCCATTACATATGCAGACTG -3'
(R):5'- GTAGAAAATGCCGTGTACTTCCC -3'
Posted On 2014-05-23