Incidental Mutation 'R1754:Myh10'
ID193868
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
MMRRC Submission 039786-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1754 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68813058 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1902 (A1902E)
Ref Sequence ENSEMBL: ENSMUSP00000090661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
Predicted Effect probably damaging
Transcript: ENSMUST00000018887
AA Change: A1896E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900
AA Change: A1896E

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092984
AA Change: A1902E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900
AA Change: A1902E

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102611
AA Change: A1865E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900
AA Change: A1865E

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139059
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca2 T A 2: 25,434,333 L234M probably benign Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Acp4 T C 7: 44,255,004 I212V probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Arid1b A G 17: 5,279,201 probably null Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Dnah7a A C 1: 53,561,900 probably null Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gmeb1 A G 4: 132,232,027 S239P probably benign Het
Gnpat T A 8: 124,877,006 Y208N probably damaging Het
Il21 T C 3: 37,225,525 K114R possibly damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Nlrp3 A G 11: 59,558,402 T837A possibly damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Ptger1 A G 8: 83,669,297 N328D probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf10 A C 5: 115,245,865 S630R probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Ssh1 A T 5: 113,955,845 I276N probably damaging Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68765092 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2136:Myh10 UTSW 11 68804714 missense probably damaging 1.00
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R2351:Myh10 UTSW 11 68793139 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4668:Myh10 UTSW 11 68804642 missense probably damaging 1.00
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5288:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68785859 missense probably damaging 1.00
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7329:Myh10 UTSW 11 68810191 missense probably benign 0.44
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7681:Myh10 UTSW 11 68771936 missense probably damaging 0.98
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCTTCCATTGGCTGTAAACTC -3'
(R):5'- AAAGTGTCACTGACTCGCTCTCCC -3'

Sequencing Primer
(F):5'- GGCTGTAAACTCTTCATCTGAGAC -3'
(R):5'- CCCATTGGAACTGGGGGAAC -3'
Posted On2014-05-23