Mutagenetix > Incidental Mutation

Incidental Mutation 'R0035:Abcb6'

19387

Institutional Source

Beutler Lab

Gene Symbol

Abcb6

Ensembl Gene

ENSMUSG00000026198

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 6

Synonyms

1200005B17Rik

MMRRC Submission

038329-MU

Accession Numbers

Genbank: NM_023732.2; Ensembl: ENSMUST00000027396, ENSMUST00000161215

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R0035 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

75171717-75180392 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75175007 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 473 (V473A)

Ref Sequence

ENSEMBL: ENSMUSP00000027396 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027394] [ENSMUST00000027396] [ENSMUST00000160439] [ENSMUST00000161215] [ENSMUST00000162768]

AlphaFold

Q9DC29

Predicted Effect

probably benign
Transcript: ENSMUST00000027394

SMART Domains

Protein: ENSMUSP00000027394
Gene: ENSMUSG00000026197

Domain	Start	End	E-Value	Type
ZnF_AN1	10	49	2e-4	SMART
low complexity region	54	66	N/A	INTRINSIC
ZnF_AN1	100	139	6.69e-3	SMART
low complexity region	155	179	N/A	INTRINSIC
UIM	197	216	1.3e-2	SMART
UIM	221	240	1.26e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027396
AA Change: V473A

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198
AA Change: V473A

Domain	Start	End	E-Value	Type
Pfam:MTABC_N	6	255	7.8e-80	PFAM
Pfam:ABC_membrane	265	544	3.7e-34	PFAM
AAA	615	816	1.29e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160033

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160081

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160282

Predicted Effect

probably benign
Transcript: ENSMUST00000160439

SMART Domains

Protein: ENSMUSP00000125086
Gene: ENSMUSG00000026197

Domain	Start	End	E-Value	Type
ZnF_AN1	10	49	2e-4	SMART
low complexity region	54	66	N/A	INTRINSIC
ZnF_AN1	100	139	6.69e-3	SMART
low complexity region	155	179	N/A	INTRINSIC
UIM	197	216	1.3e-2	SMART
UIM	221	240	1.26e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160757

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161103

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161106

Predicted Effect

probably benign
Transcript: ENSMUST00000161215

SMART Domains

Protein: ENSMUSP00000124630
Gene: ENSMUSG00000026198

Domain	Start	End	E-Value	Type
SCOP:d1jj7a_	5	78	8e-23	SMART
Blast:AAA	23	71	9e-25	BLAST
PDB:3NHB\|A	23	94	3e-36	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000162768

SMART Domains

Protein: ENSMUSP00000124552
Gene: ENSMUSG00000026197

Domain	Start	End	E-Value	Type
ZnF_AN1	10	49	2e-4	SMART
low complexity region	54	66	N/A	INTRINSIC
ZnF_AN1	100	139	6.69e-3	SMART
low complexity region	155	179	N/A	INTRINSIC
UIM	197	216	1.3e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185727

Predicted Effect

probably benign
Transcript: ENSMUST00000186227

Meta Mutation Damage Score

0.4717

Coding Region Coverage

1x: 99.1%
3x: 97.8%
10x: 94.7%
20x: 87.1%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This half-transporter likely plays a role in mitochondrial function. Localized to 2q26, this gene is considered a candidate gene for lethal neonatal metabolic syndrome, a disorder of mitochondrial function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, impaired stress erythropoiesis, and absence of ATP-dependent transport of Coproporphyrin III in mitochondria. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110040N11Rik	T	C	7: 81,788,549	T20A	probably benign	Het
4932438A13Rik	T	A	3: 36,987,598	Y2708*	probably null	Het
9130011E15Rik	A	T	19: 45,891,240	M558K	probably damaging	Het
Aadacl4	A	G	4: 144,617,941	T96A	probably damaging	Het
Abo	C	A	2: 26,843,373	K273N	possibly damaging	Het
Acvr1c	A	G	2: 58,315,779		probably benign	Het
Adcy8	A	T	15: 64,699,368	V1142D	probably benign	Het
Akna	T	A	4: 63,382,445	H591L	probably benign	Het
Aox2	T	C	1: 58,354,422	V1247A	probably benign	Het
Ap4b1	T	C	3: 103,820,664		probably benign	Het
Atm	A	G	9: 53,513,180	V607A	probably benign	Het
Cass4	C	T	2: 172,416,492	P137S	probably damaging	Het
Cfap53	A	G	18: 74,300,207	E121G	probably damaging	Het
Chmp6	T	C	11: 119,916,682	V31A	probably damaging	Het
Clec4a3	T	A	6: 122,967,549	Y185N	probably damaging	Het
Clic5	A	G	17: 44,275,313	T230A	probably damaging	Het
Clspn	G	T	4: 126,565,003		probably null	Het
Cntn1	T	A	15: 92,232,088		probably benign	Het
Col4a3	G	A	1: 82,672,753	G577R	unknown	Het
Defa21	T	A	8: 21,025,768		probably null	Het
Deup1	T	C	9: 15,599,821	R221G	possibly damaging	Het
Dnah8	A	T	17: 30,683,621		probably benign	Het
Dnase1l2	A	G	17: 24,441,075	V273A	probably damaging	Het
Gm5134	T	A	10: 75,993,864	F328Y	probably benign	Het
Golph3	A	T	15: 12,339,690	E96D	probably damaging	Het
Hspd1	A	G	1: 55,083,783	V151A	probably benign	Het
Htr1f	A	C	16: 64,926,497	I144S	probably damaging	Het
Il1f8	A	T	2: 24,159,878	H167L	probably benign	Het
Il23r	A	G	6: 67,473,788		probably benign	Het
Il25	A	G	14: 54,933,096	E42G	probably damaging	Het
Klrb1-ps1	C	T	6: 129,129,343	A149V	possibly damaging	Het
Kmt2e	T	A	5: 23,485,621		probably benign	Het
Ktn1	A	G	14: 47,730,379	N1167D	probably benign	Het
Lama4	T	A	10: 39,072,738	D832E	probably benign	Het
Map1b	A	G	13: 99,435,338	S292P	probably damaging	Het
Map6	C	T	7: 99,317,608	T345I	probably damaging	Het
Mark2	A	T	19: 7,284,652		probably benign	Het
Me3	C	A	7: 89,851,759	H559Q	probably benign	Het
Myo1b	A	G	1: 51,778,382	F574L	probably damaging	Het
Nos2	T	C	11: 78,945,727	S431P	probably damaging	Het
Nr1h5	T	A	3: 102,949,573	K208*	probably null	Het
Nup214	T	C	2: 31,990,367		probably null	Het
Obp2b	T	C	2: 25,738,633	L133P	probably damaging	Het
Olfr173	A	T	16: 58,797,122	C241*	probably null	Het
Olfr305	T	C	7: 86,364,187	D50G	possibly damaging	Het
Osbp2	C	T	11: 3,717,997		probably benign	Het
Ptafr	C	A	4: 132,579,553	L85I	probably benign	Het
Ptprk	T	A	10: 28,263,508	Y76*	probably null	Het
Rad50	A	G	11: 53,655,027		probably benign	Het
Rasef	G	T	4: 73,762,854		probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Tbc1d1	T	A	5: 64,256,737	I18N	probably damaging	Het
Tbc1d17	T	C	7: 44,841,408	N587D	probably benign	Het
Trank1	A	T	9: 111,366,776	K1289N	probably benign	Het
Tspyl3	A	G	2: 153,224,320	S333P	probably damaging	Het
Ush2a	G	A	1: 188,356,888	V347I	probably benign	Het
Usp17le	G	T	7: 104,769,062	S291*	probably null	Het
Usp24	T	A	4: 106,368,027	S619T	probably benign	Het
Vmn2r10	T	C	5: 108,997,601		probably benign	Het
Vmn2r78	A	G	7: 86,920,205	E102G	probably benign	Het
Vwa3b	G	A	1: 37,165,689	V85I	possibly damaging	Het
Wwp1	A	C	4: 19,631,116	I639R	probably damaging	Het
Xpo5	A	G	17: 46,240,175	T1001A	probably benign	Het
Zc3h12c	A	T	9: 52,143,747	M235K	probably benign	Het
Zfp619	G	A	7: 39,537,282	G912D	probably damaging	Het

Other mutations in Abcb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02836:Abcb6	APN	1	75178002	missense	probably damaging	0.96
1mM(1):Abcb6	UTSW	1	75172111	unclassified	probably benign
R0699:Abcb6	UTSW	1	75171909	missense	probably damaging	0.98
R1470:Abcb6	UTSW	1	75172679	unclassified	probably benign
R1595:Abcb6	UTSW	1	75177300	splice site	probably null
R1912:Abcb6	UTSW	1	75179955	missense	probably benign
R2078:Abcb6	UTSW	1	75172136	missense	probably damaging	1.00
R3105:Abcb6	UTSW	1	75175043	unclassified	probably benign
R4015:Abcb6	UTSW	1	75174491	splice site	probably null
R4604:Abcb6	UTSW	1	75179877	missense	probably benign
R4633:Abcb6	UTSW	1	75177782	unclassified	probably benign
R4748:Abcb6	UTSW	1	75177358	missense	probably damaging	1.00
R5530:Abcb6	UTSW	1	75177912	unclassified	probably benign
R5654:Abcb6	UTSW	1	75174835	splice site	probably null
R5841:Abcb6	UTSW	1	75174350	missense	possibly damaging	0.88
R6275:Abcb6	UTSW	1	75172551	splice site	probably null
R6527:Abcb6	UTSW	1	75177488	critical splice acceptor site	probably null
R7188:Abcb6	UTSW	1	75174137	critical splice donor site	probably null
R7278:Abcb6	UTSW	1	75174373	missense	possibly damaging	0.88
R7451:Abcb6	UTSW	1	75172153	missense	probably damaging	1.00
R7481:Abcb6	UTSW	1	75173604	missense	probably damaging	1.00
R7608:Abcb6	UTSW	1	75177703	missense	probably benign	0.01
R7640:Abcb6	UTSW	1	75174845	splice site	probably null
R7883:Abcb6	UTSW	1	75178016	missense	possibly damaging	0.81
R7982:Abcb6	UTSW	1	75173640	missense	probably damaging	1.00
R8057:Abcb6	UTSW	1	75174358	missense	probably damaging	0.99
R8058:Abcb6	UTSW	1	75180009	missense	possibly damaging	0.79
R8155:Abcb6	UTSW	1	75174769	missense	probably damaging	0.99
R8309:Abcb6	UTSW	1	75172944	missense	probably benign	0.43
R9087:Abcb6	UTSW	1	75173567	missense	probably damaging	1.00
R9599:Abcb6	UTSW	1	75174728	missense	possibly damaging	0.63
R9723:Abcb6	UTSW	1	75179722	missense	probably benign
X0009:Abcb6	UTSW	1	75174553	missense	probably benign	0.35
Z1177:Abcb6	UTSW	1	75176125	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTGATTCAGCACAACCAGTGAGG -3'
(R):5'- AACGGTAACAGTCGCCCTGAGATG -3'

Sequencing Primer
(F):5'- TGAGGCGGTTGACTTCCAC -3'
(R):5'- gaagcagaggcaggtgg -3'

Posted On

2013-04-11