Incidental Mutation 'R1754:Arid1b'
ID 193889
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene Name AT-rich interaction domain 1B
Synonyms 9330189K18Rik, B230217J03Rik
MMRRC Submission 039786-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.813) question?
Stock # R1754 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 5044607-5397931 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 5329476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000092723] [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115797] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000115799] [ENSMUST00000115799] [ENSMUST00000232180] [ENSMUST00000232180] [ENSMUST00000232180]
AlphaFold E9Q4N7
Predicted Effect probably null
Transcript: ENSMUST00000092723
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092723
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092723
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115797
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115797
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115797
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115799
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115799
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115799
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000232180
Predicted Effect probably null
Transcript: ENSMUST00000232180
Predicted Effect probably null
Transcript: ENSMUST00000232180
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,324,345 (GRCm39) L234M probably benign Het
Abca3 G A 17: 24,596,753 (GRCm39) S402N probably benign Het
Acad12 A T 5: 121,745,544 (GRCm39) V249D probably benign Het
Acp4 T C 7: 43,904,428 (GRCm39) I212V probably benign Het
Actl6a T A 3: 32,772,723 (GRCm39) V233D probably damaging Het
Aire T A 10: 77,866,124 (GRCm39) Q533L probably damaging Het
Aldh3b3 T C 19: 4,018,517 (GRCm39) S411P probably benign Het
Amer2 A G 14: 60,617,206 (GRCm39) K467R probably damaging Het
Apol9b A T 15: 77,619,962 (GRCm39) I253F probably benign Het
Atp6v0a4 T C 6: 38,044,764 (GRCm39) T494A probably benign Het
Atp6v1b2 A G 8: 69,554,613 (GRCm39) D106G probably benign Het
Avpr1b T C 1: 131,527,839 (GRCm39) S121P probably damaging Het
Bcl11a A C 11: 24,114,724 (GRCm39) E689A probably damaging Het
Brpf3 T G 17: 29,040,297 (GRCm39) L906R probably benign Het
Btn1a1 T C 13: 23,644,638 (GRCm39) K287E probably benign Het
Cacna1i A G 15: 80,255,730 (GRCm39) H871R probably damaging Het
Cd14 A T 18: 36,858,567 (GRCm39) L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Colgalt1 G T 8: 72,075,823 (GRCm39) W490L probably damaging Het
Ctnna2 A G 6: 77,613,732 (GRCm39) I273T possibly damaging Het
Dnah7a A T 1: 53,543,344 (GRCm39) D2275E probably benign Het
Dnah7a A C 1: 53,601,059 (GRCm39) probably null Het
Egfem1 T C 3: 29,722,482 (GRCm39) Y404H possibly damaging Het
Esm1 A T 13: 113,353,230 (GRCm39) N171Y probably damaging Het
Exoc1 T G 5: 76,708,169 (GRCm39) probably null Het
Fam243 A G 16: 92,117,919 (GRCm39) V123A probably damaging Het
Fcho1 A G 8: 72,163,890 (GRCm39) I580T probably benign Het
Fgfr1 A G 8: 26,060,226 (GRCm39) H552R probably damaging Het
Fsbp A G 4: 11,583,906 (GRCm39) R202G probably damaging Het
Gabra6 A G 11: 42,207,388 (GRCm39) V231A probably damaging Het
Gmeb1 A G 4: 131,959,338 (GRCm39) S239P probably benign Het
Gnpat T A 8: 125,603,745 (GRCm39) Y208N probably damaging Het
Il21 T C 3: 37,279,674 (GRCm39) K114R possibly damaging Het
Inhbc T C 10: 127,206,162 (GRCm39) D35G possibly damaging Het
Inpp4b A T 8: 82,497,440 (GRCm39) T87S probably damaging Het
Kcns2 T C 15: 34,839,663 (GRCm39) I342T possibly damaging Het
Ky A T 9: 102,419,126 (GRCm39) T378S possibly damaging Het
Lcat CAT C 8: 106,668,446 (GRCm39) probably null Het
Lrrc8d T C 5: 105,960,523 (GRCm39) V311A probably benign Het
Mief1 A G 15: 80,133,803 (GRCm39) I287V probably damaging Het
Mrpl47 A G 3: 32,784,233 (GRCm39) V179A probably benign Het
Mtcl1 T C 17: 66,687,178 (GRCm39) K576R probably damaging Het
Myh10 C A 11: 68,703,884 (GRCm39) A1902E probably damaging Het
Nlrp3 A G 11: 59,449,228 (GRCm39) T837A possibly damaging Het
Nr1i3 T C 1: 171,044,963 (GRCm39) Y132H probably damaging Het
Oit3 T C 10: 59,263,762 (GRCm39) probably null Het
Or12j4 A T 7: 140,046,773 (GRCm39) I220F probably damaging Het
Or2z2 A T 11: 58,346,088 (GRCm39) M229K probably damaging Het
Or4c100 A T 2: 88,356,159 (GRCm39) R77S probably damaging Het
Or5b113 T C 19: 13,342,717 (GRCm39) S242P probably damaging Het
Or5h25 T A 16: 58,930,944 (GRCm39) I10F probably benign Het
Or6k14 A G 1: 173,927,599 (GRCm39) T192A probably benign Het
Or7a42 T A 10: 78,791,531 (GRCm39) V164E probably damaging Het
Or9k2 G A 10: 129,999,033 (GRCm39) T54I probably benign Het
Pdlim4 T C 11: 53,946,699 (GRCm39) E196G possibly damaging Het
Pigs A G 11: 78,228,673 (GRCm39) Y293C probably damaging Het
Pkd1l2 A T 8: 117,757,458 (GRCm39) S1527T possibly damaging Het
Pkd2l1 A T 19: 44,144,040 (GRCm39) Y344* probably null Het
Pmp2 T C 3: 10,247,284 (GRCm39) probably null Het
Polr3e T C 7: 120,538,521 (GRCm39) probably null Het
Ppp3ca C G 3: 136,587,209 (GRCm39) I230M probably benign Het
Ppp5c T C 7: 16,739,235 (GRCm39) H463R probably benign Het
Ptger1 A G 8: 84,395,926 (GRCm39) N328D probably benign Het
Rhno1 A T 6: 128,334,822 (GRCm39) I167N probably benign Het
Rictor C A 15: 6,764,849 (GRCm39) P34H probably damaging Het
Rnf10 A C 5: 115,383,924 (GRCm39) S630R probably damaging Het
Rnf168 A G 16: 32,117,942 (GRCm39) Q501R probably benign Het
Rngtt T G 4: 33,329,634 (GRCm39) probably null Het
Samd9l G T 6: 3,373,126 (GRCm39) F1378L probably damaging Het
Slc9c1 T A 16: 45,409,872 (GRCm39) M864K probably benign Het
Slitrk5 T C 14: 111,917,951 (GRCm39) F525S probably damaging Het
Sox6 T C 7: 115,076,290 (GRCm39) M784V probably benign Het
Spata31e4 A T 13: 50,855,123 (GRCm39) T254S probably damaging Het
Spint2 C T 7: 28,959,791 (GRCm39) probably null Het
Ssh1 A T 5: 114,093,906 (GRCm39) I276N probably damaging Het
Trank1 T A 9: 111,221,939 (GRCm39) V2892D probably benign Het
Ttn C A 2: 76,581,384 (GRCm39) E21424* probably null Het
Usp17lc T C 7: 103,068,055 (GRCm39) I450T probably benign Het
Vcan A G 13: 89,852,854 (GRCm39) V702A probably benign Het
Vmn1r36 TA TAA 6: 66,693,517 (GRCm39) probably null Het
Vmn2r51 G T 7: 9,833,873 (GRCm39) D388E probably benign Het
Zfp106 G A 2: 120,364,244 (GRCm39) S721L probably damaging Het
Zfp106 A C 2: 120,364,245 (GRCm39) S721A probably damaging Het
Zfp189 T A 4: 49,529,342 (GRCm39) H148Q possibly damaging Het
Zfp352 A T 4: 90,112,046 (GRCm39) Y62F probably benign Het
Zfp839 T C 12: 110,821,891 (GRCm39) V235A probably damaging Het
Zfp871 T C 17: 32,994,308 (GRCm39) Y289C probably damaging Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5,387,385 (GRCm39) missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5,371,559 (GRCm39) missense probably damaging 1.00
IGL00886:Arid1b APN 17 5,177,254 (GRCm39) missense probably damaging 0.99
IGL01161:Arid1b APN 17 5,392,674 (GRCm39) missense probably damaging 1.00
IGL01391:Arid1b APN 17 5,369,133 (GRCm39) splice site probably benign
IGL01456:Arid1b APN 17 5,341,510 (GRCm39) missense probably damaging 1.00
IGL02152:Arid1b APN 17 5,364,243 (GRCm39) missense probably damaging 1.00
IGL02288:Arid1b APN 17 5,314,315 (GRCm39) missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5,393,286 (GRCm39) missense probably damaging 1.00
IGL02858:Arid1b APN 17 5,392,166 (GRCm39) missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5,392,428 (GRCm39) missense probably damaging 1.00
IGL02989:Arid1b APN 17 5,385,322 (GRCm39) missense probably damaging 1.00
FR4449:Arid1b UTSW 17 5,045,864 (GRCm39) small insertion probably benign
PIT4142001:Arid1b UTSW 17 5,389,518 (GRCm39) missense probably damaging 1.00
R0048:Arid1b UTSW 17 5,364,309 (GRCm39) critical splice donor site probably null
R0124:Arid1b UTSW 17 5,389,605 (GRCm39) missense probably damaging 1.00
R0153:Arid1b UTSW 17 5,393,207 (GRCm39) missense probably damaging 1.00
R0465:Arid1b UTSW 17 5,046,535 (GRCm39) missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5,392,453 (GRCm39) missense probably damaging 1.00
R1172:Arid1b UTSW 17 5,389,575 (GRCm39) missense probably damaging 1.00
R1468:Arid1b UTSW 17 5,293,197 (GRCm39) missense probably damaging 0.99
R1468:Arid1b UTSW 17 5,293,197 (GRCm39) missense probably damaging 0.99
R1616:Arid1b UTSW 17 5,389,569 (GRCm39) missense probably damaging 1.00
R1760:Arid1b UTSW 17 5,392,088 (GRCm39) missense probably damaging 0.97
R1812:Arid1b UTSW 17 5,387,304 (GRCm39) missense probably benign 0.10
R1911:Arid1b UTSW 17 5,393,241 (GRCm39) missense probably damaging 1.00
R3874:Arid1b UTSW 17 5,386,790 (GRCm39) splice site probably null
R3913:Arid1b UTSW 17 5,392,532 (GRCm39) missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5,392,928 (GRCm39) missense probably benign 0.25
R3922:Arid1b UTSW 17 5,393,316 (GRCm39) missense probably damaging 0.97
R4119:Arid1b UTSW 17 5,046,069 (GRCm39) unclassified probably benign
R4290:Arid1b UTSW 17 5,090,938 (GRCm39) missense probably damaging 1.00
R4291:Arid1b UTSW 17 5,090,938 (GRCm39) missense probably damaging 1.00
R4352:Arid1b UTSW 17 5,147,859 (GRCm39) missense possibly damaging 0.93
R4386:Arid1b UTSW 17 5,045,247 (GRCm39) unclassified probably benign
R4458:Arid1b UTSW 17 5,293,191 (GRCm39) missense probably damaging 0.99
R4524:Arid1b UTSW 17 5,147,895 (GRCm39) missense possibly damaging 0.93
R4622:Arid1b UTSW 17 5,045,325 (GRCm39) unclassified probably benign
R4723:Arid1b UTSW 17 5,387,565 (GRCm39) missense probably benign 0.01
R4782:Arid1b UTSW 17 5,389,496 (GRCm39) missense probably damaging 1.00
R4799:Arid1b UTSW 17 5,389,496 (GRCm39) missense probably damaging 1.00
R4910:Arid1b UTSW 17 5,392,478 (GRCm39) missense probably damaging 1.00
R4946:Arid1b UTSW 17 5,393,118 (GRCm39) missense probably damaging 0.99
R5083:Arid1b UTSW 17 5,364,293 (GRCm39) missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5,393,316 (GRCm39) missense probably damaging 0.97
R5347:Arid1b UTSW 17 5,341,332 (GRCm39) nonsense probably null
R5553:Arid1b UTSW 17 5,364,152 (GRCm39) missense probably damaging 1.00
R5713:Arid1b UTSW 17 5,387,091 (GRCm39) missense probably damaging 1.00
R5820:Arid1b UTSW 17 5,046,529 (GRCm39) missense possibly damaging 0.96
R5992:Arid1b UTSW 17 5,045,231 (GRCm39) unclassified probably benign
R6038:Arid1b UTSW 17 5,386,957 (GRCm39) missense probably benign 0.07
R6038:Arid1b UTSW 17 5,386,957 (GRCm39) missense probably benign 0.07
R6153:Arid1b UTSW 17 5,293,107 (GRCm39) missense probably damaging 1.00
R6222:Arid1b UTSW 17 5,377,922 (GRCm39) critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5,329,636 (GRCm39) missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5,392,274 (GRCm39) missense probably damaging 1.00
R6329:Arid1b UTSW 17 5,387,538 (GRCm39) nonsense probably null
R6368:Arid1b UTSW 17 5,382,808 (GRCm39) missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5,377,953 (GRCm39) missense probably damaging 1.00
R6861:Arid1b UTSW 17 5,377,961 (GRCm39) missense possibly damaging 0.93
R7008:Arid1b UTSW 17 5,341,254 (GRCm39) missense probably damaging 1.00
R7270:Arid1b UTSW 17 5,046,318 (GRCm39) missense unknown
R7514:Arid1b UTSW 17 5,391,989 (GRCm39) missense probably benign 0.28
R7519:Arid1b UTSW 17 5,046,128 (GRCm39) small insertion probably benign
R7519:Arid1b UTSW 17 5,046,119 (GRCm39) small insertion probably benign
R7521:Arid1b UTSW 17 5,392,865 (GRCm39) missense probably benign 0.06
R7521:Arid1b UTSW 17 5,046,119 (GRCm39) small insertion probably benign
R7521:Arid1b UTSW 17 5,046,135 (GRCm39) small insertion probably benign
R7616:Arid1b UTSW 17 5,045,661 (GRCm39) missense unknown
R7654:Arid1b UTSW 17 5,341,360 (GRCm39) missense possibly damaging 0.46
R7711:Arid1b UTSW 17 5,387,095 (GRCm39) missense probably benign 0.28
R7828:Arid1b UTSW 17 5,147,943 (GRCm39) missense probably damaging 1.00
R7864:Arid1b UTSW 17 5,392,530 (GRCm39) missense probably damaging 1.00
R7998:Arid1b UTSW 17 5,377,959 (GRCm39) missense probably damaging 1.00
R8105:Arid1b UTSW 17 5,341,518 (GRCm39) missense possibly damaging 0.81
R8260:Arid1b UTSW 17 5,382,788 (GRCm39) missense probably benign 0.03
R8374:Arid1b UTSW 17 5,392,919 (GRCm39) missense possibly damaging 0.95
R8779:Arid1b UTSW 17 5,391,809 (GRCm39) missense probably benign 0.03
R8801:Arid1b UTSW 17 5,387,103 (GRCm39) missense probably benign 0.05
R8894:Arid1b UTSW 17 5,377,668 (GRCm39) missense probably damaging 0.98
R8982:Arid1b UTSW 17 5,293,316 (GRCm39) missense probably damaging 0.98
R9034:Arid1b UTSW 17 5,387,180 (GRCm39) missense probably benign 0.01
R9272:Arid1b UTSW 17 5,386,879 (GRCm39) missense possibly damaging 0.80
R9300:Arid1b UTSW 17 5,293,274 (GRCm39) missense probably damaging 1.00
R9332:Arid1b UTSW 17 5,045,584 (GRCm39) missense unknown
R9481:Arid1b UTSW 17 5,369,007 (GRCm39) missense probably damaging 1.00
R9493:Arid1b UTSW 17 5,046,423 (GRCm39) missense unknown
R9512:Arid1b UTSW 17 5,391,864 (GRCm39) missense probably benign 0.00
R9548:Arid1b UTSW 17 5,385,262 (GRCm39) missense probably damaging 1.00
RF007:Arid1b UTSW 17 5,045,869 (GRCm39) small insertion probably benign
RF008:Arid1b UTSW 17 5,045,870 (GRCm39) small insertion probably benign
RF008:Arid1b UTSW 17 5,045,869 (GRCm39) small insertion probably benign
RF025:Arid1b UTSW 17 5,045,871 (GRCm39) small insertion probably benign
RF025:Arid1b UTSW 17 5,045,863 (GRCm39) small insertion probably benign
RF028:Arid1b UTSW 17 5,045,873 (GRCm39) small insertion probably benign
RF032:Arid1b UTSW 17 5,045,863 (GRCm39) small insertion probably benign
RF033:Arid1b UTSW 17 5,045,860 (GRCm39) small insertion probably benign
RF041:Arid1b UTSW 17 5,045,870 (GRCm39) small insertion probably benign
RF045:Arid1b UTSW 17 5,045,858 (GRCm39) small insertion probably benign
RF046:Arid1b UTSW 17 5,045,865 (GRCm39) small insertion probably benign
RF058:Arid1b UTSW 17 5,045,858 (GRCm39) small insertion probably benign
X0023:Arid1b UTSW 17 5,392,668 (GRCm39) missense probably benign 0.39
X0027:Arid1b UTSW 17 5,392,647 (GRCm39) nonsense probably null
Z1177:Arid1b UTSW 17 5,046,603 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACAAAGGTGACCTCATGCTGACTG -3'
(R):5'- CCTCCCACCATGCATTTTGGAGAAC -3'

Sequencing Primer
(F):5'- TCAAGGCCACTGACTATTGG -3'
(R):5'- GAGAACGTCTTGCTTTGTTACC -3'
Posted On 2014-05-23