Incidental Mutation 'R1754:Brpf3'
ID 193891
Institutional Source Beutler Lab
Gene Symbol Brpf3
Ensembl Gene ENSMUSG00000063952
Gene Name bromodomain and PHD finger containing, 3
Synonyms
MMRRC Submission 039786-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.459) question?
Stock # R1754 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 29020088-29057763 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 29040297 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 906 (L906R)
Ref Sequence ENSEMBL: ENSMUSP00000004985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004985]
AlphaFold B2KF05
Predicted Effect probably benign
Transcript: ENSMUST00000004985
AA Change: L906R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004985
Gene: ENSMUSG00000063952
AA Change: L906R

DomainStartEndE-ValueType
Pfam:EPL1 48 194 8.4e-38 PFAM
PHD 214 260 7.07e-5 SMART
PHD 324 387 4.74e-6 SMART
low complexity region 405 436 N/A INTRINSIC
Blast:BROMO 491 534 7e-21 BLAST
low complexity region 558 577 N/A INTRINSIC
BROMO 586 694 4.93e-39 SMART
low complexity region 777 792 N/A INTRINSIC
low complexity region 813 823 N/A INTRINSIC
PWWP 1073 1156 2.07e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156029
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in any obvious neurological, behavioral, developmental, histological, hematological, survival or reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,324,345 (GRCm39) L234M probably benign Het
Abca3 G A 17: 24,596,753 (GRCm39) S402N probably benign Het
Acad12 A T 5: 121,745,544 (GRCm39) V249D probably benign Het
Acp4 T C 7: 43,904,428 (GRCm39) I212V probably benign Het
Actl6a T A 3: 32,772,723 (GRCm39) V233D probably damaging Het
Aire T A 10: 77,866,124 (GRCm39) Q533L probably damaging Het
Aldh3b3 T C 19: 4,018,517 (GRCm39) S411P probably benign Het
Amer2 A G 14: 60,617,206 (GRCm39) K467R probably damaging Het
Apol9b A T 15: 77,619,962 (GRCm39) I253F probably benign Het
Arid1b A G 17: 5,329,476 (GRCm39) probably null Het
Atp6v0a4 T C 6: 38,044,764 (GRCm39) T494A probably benign Het
Atp6v1b2 A G 8: 69,554,613 (GRCm39) D106G probably benign Het
Avpr1b T C 1: 131,527,839 (GRCm39) S121P probably damaging Het
Bcl11a A C 11: 24,114,724 (GRCm39) E689A probably damaging Het
Btn1a1 T C 13: 23,644,638 (GRCm39) K287E probably benign Het
Cacna1i A G 15: 80,255,730 (GRCm39) H871R probably damaging Het
Cd14 A T 18: 36,858,567 (GRCm39) L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Colgalt1 G T 8: 72,075,823 (GRCm39) W490L probably damaging Het
Ctnna2 A G 6: 77,613,732 (GRCm39) I273T possibly damaging Het
Dnah7a A T 1: 53,543,344 (GRCm39) D2275E probably benign Het
Dnah7a A C 1: 53,601,059 (GRCm39) probably null Het
Egfem1 T C 3: 29,722,482 (GRCm39) Y404H possibly damaging Het
Esm1 A T 13: 113,353,230 (GRCm39) N171Y probably damaging Het
Exoc1 T G 5: 76,708,169 (GRCm39) probably null Het
Fam243 A G 16: 92,117,919 (GRCm39) V123A probably damaging Het
Fcho1 A G 8: 72,163,890 (GRCm39) I580T probably benign Het
Fgfr1 A G 8: 26,060,226 (GRCm39) H552R probably damaging Het
Fsbp A G 4: 11,583,906 (GRCm39) R202G probably damaging Het
Gabra6 A G 11: 42,207,388 (GRCm39) V231A probably damaging Het
Gmeb1 A G 4: 131,959,338 (GRCm39) S239P probably benign Het
Gnpat T A 8: 125,603,745 (GRCm39) Y208N probably damaging Het
Il21 T C 3: 37,279,674 (GRCm39) K114R possibly damaging Het
Inhbc T C 10: 127,206,162 (GRCm39) D35G possibly damaging Het
Inpp4b A T 8: 82,497,440 (GRCm39) T87S probably damaging Het
Kcns2 T C 15: 34,839,663 (GRCm39) I342T possibly damaging Het
Ky A T 9: 102,419,126 (GRCm39) T378S possibly damaging Het
Lcat CAT C 8: 106,668,446 (GRCm39) probably null Het
Lrrc8d T C 5: 105,960,523 (GRCm39) V311A probably benign Het
Mief1 A G 15: 80,133,803 (GRCm39) I287V probably damaging Het
Mrpl47 A G 3: 32,784,233 (GRCm39) V179A probably benign Het
Mtcl1 T C 17: 66,687,178 (GRCm39) K576R probably damaging Het
Myh10 C A 11: 68,703,884 (GRCm39) A1902E probably damaging Het
Nlrp3 A G 11: 59,449,228 (GRCm39) T837A possibly damaging Het
Nr1i3 T C 1: 171,044,963 (GRCm39) Y132H probably damaging Het
Oit3 T C 10: 59,263,762 (GRCm39) probably null Het
Or12j4 A T 7: 140,046,773 (GRCm39) I220F probably damaging Het
Or2z2 A T 11: 58,346,088 (GRCm39) M229K probably damaging Het
Or4c100 A T 2: 88,356,159 (GRCm39) R77S probably damaging Het
Or5b113 T C 19: 13,342,717 (GRCm39) S242P probably damaging Het
Or5h25 T A 16: 58,930,944 (GRCm39) I10F probably benign Het
Or6k14 A G 1: 173,927,599 (GRCm39) T192A probably benign Het
Or7a42 T A 10: 78,791,531 (GRCm39) V164E probably damaging Het
Or9k2 G A 10: 129,999,033 (GRCm39) T54I probably benign Het
Pdlim4 T C 11: 53,946,699 (GRCm39) E196G possibly damaging Het
Pigs A G 11: 78,228,673 (GRCm39) Y293C probably damaging Het
Pkd1l2 A T 8: 117,757,458 (GRCm39) S1527T possibly damaging Het
Pkd2l1 A T 19: 44,144,040 (GRCm39) Y344* probably null Het
Pmp2 T C 3: 10,247,284 (GRCm39) probably null Het
Polr3e T C 7: 120,538,521 (GRCm39) probably null Het
Ppp3ca C G 3: 136,587,209 (GRCm39) I230M probably benign Het
Ppp5c T C 7: 16,739,235 (GRCm39) H463R probably benign Het
Ptger1 A G 8: 84,395,926 (GRCm39) N328D probably benign Het
Rhno1 A T 6: 128,334,822 (GRCm39) I167N probably benign Het
Rictor C A 15: 6,764,849 (GRCm39) P34H probably damaging Het
Rnf10 A C 5: 115,383,924 (GRCm39) S630R probably damaging Het
Rnf168 A G 16: 32,117,942 (GRCm39) Q501R probably benign Het
Rngtt T G 4: 33,329,634 (GRCm39) probably null Het
Samd9l G T 6: 3,373,126 (GRCm39) F1378L probably damaging Het
Slc9c1 T A 16: 45,409,872 (GRCm39) M864K probably benign Het
Slitrk5 T C 14: 111,917,951 (GRCm39) F525S probably damaging Het
Sox6 T C 7: 115,076,290 (GRCm39) M784V probably benign Het
Spata31e4 A T 13: 50,855,123 (GRCm39) T254S probably damaging Het
Spint2 C T 7: 28,959,791 (GRCm39) probably null Het
Ssh1 A T 5: 114,093,906 (GRCm39) I276N probably damaging Het
Trank1 T A 9: 111,221,939 (GRCm39) V2892D probably benign Het
Ttn C A 2: 76,581,384 (GRCm39) E21424* probably null Het
Usp17lc T C 7: 103,068,055 (GRCm39) I450T probably benign Het
Vcan A G 13: 89,852,854 (GRCm39) V702A probably benign Het
Vmn1r36 TA TAA 6: 66,693,517 (GRCm39) probably null Het
Vmn2r51 G T 7: 9,833,873 (GRCm39) D388E probably benign Het
Zfp106 A C 2: 120,364,245 (GRCm39) S721A probably damaging Het
Zfp106 G A 2: 120,364,244 (GRCm39) S721L probably damaging Het
Zfp189 T A 4: 49,529,342 (GRCm39) H148Q possibly damaging Het
Zfp352 A T 4: 90,112,046 (GRCm39) Y62F probably benign Het
Zfp839 T C 12: 110,821,891 (GRCm39) V235A probably damaging Het
Zfp871 T C 17: 32,994,308 (GRCm39) Y289C probably damaging Het
Other mutations in Brpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Brpf3 APN 17 29,055,674 (GRCm39) utr 3 prime probably benign
IGL01397:Brpf3 APN 17 29,036,606 (GRCm39) missense probably benign 0.22
IGL01608:Brpf3 APN 17 29,040,491 (GRCm39) missense probably benign 0.00
IGL02073:Brpf3 APN 17 29,026,370 (GRCm39) missense probably benign
IGL02540:Brpf3 APN 17 29,047,328 (GRCm39) missense probably damaging 1.00
IGL02838:Brpf3 APN 17 29,054,758 (GRCm39) missense probably benign 0.19
IGL02888:Brpf3 APN 17 29,047,365 (GRCm39) missense probably damaging 1.00
IGL02969:Brpf3 APN 17 29,040,279 (GRCm39) missense probably benign 0.05
IGL03036:Brpf3 APN 17 29,043,022 (GRCm39) missense possibly damaging 0.89
IGL03084:Brpf3 APN 17 29,054,751 (GRCm39) missense probably damaging 0.98
R0448:Brpf3 UTSW 17 29,025,010 (GRCm39) missense probably benign 0.10
R0898:Brpf3 UTSW 17 29,025,964 (GRCm39) missense possibly damaging 0.65
R1268:Brpf3 UTSW 17 29,055,530 (GRCm39) missense probably damaging 0.98
R1639:Brpf3 UTSW 17 29,043,042 (GRCm39) critical splice donor site probably null
R1867:Brpf3 UTSW 17 29,026,342 (GRCm39) missense probably benign
R1954:Brpf3 UTSW 17 29,025,533 (GRCm39) missense probably benign
R2000:Brpf3 UTSW 17 29,040,531 (GRCm39) missense probably benign 0.20
R2064:Brpf3 UTSW 17 29,040,338 (GRCm39) missense probably benign
R2209:Brpf3 UTSW 17 29,047,394 (GRCm39) missense probably damaging 0.98
R2413:Brpf3 UTSW 17 29,024,924 (GRCm39) start gained probably benign
R3977:Brpf3 UTSW 17 29,026,016 (GRCm39) missense possibly damaging 0.49
R4067:Brpf3 UTSW 17 29,040,233 (GRCm39) missense probably benign
R4291:Brpf3 UTSW 17 29,042,949 (GRCm39) missense probably benign 0.00
R4369:Brpf3 UTSW 17 29,055,594 (GRCm39) missense probably damaging 1.00
R4371:Brpf3 UTSW 17 29,055,594 (GRCm39) missense probably damaging 1.00
R4741:Brpf3 UTSW 17 29,036,758 (GRCm39) missense possibly damaging 0.50
R4773:Brpf3 UTSW 17 29,040,233 (GRCm39) missense probably benign 0.00
R4824:Brpf3 UTSW 17 29,025,460 (GRCm39) missense probably benign
R5360:Brpf3 UTSW 17 29,029,536 (GRCm39) missense probably benign
R5923:Brpf3 UTSW 17 29,025,610 (GRCm39) missense possibly damaging 0.90
R6181:Brpf3 UTSW 17 29,029,555 (GRCm39) missense probably damaging 1.00
R6278:Brpf3 UTSW 17 29,040,258 (GRCm39) missense probably benign 0.00
R6702:Brpf3 UTSW 17 29,029,633 (GRCm39) missense probably benign 0.01
R6884:Brpf3 UTSW 17 29,050,324 (GRCm39) missense probably benign 0.03
R6920:Brpf3 UTSW 17 29,042,970 (GRCm39) missense probably benign 0.34
R6976:Brpf3 UTSW 17 29,054,751 (GRCm39) missense probably damaging 0.98
R7099:Brpf3 UTSW 17 29,025,611 (GRCm39) missense probably benign 0.06
R7108:Brpf3 UTSW 17 29,036,099 (GRCm39) missense probably benign 0.01
R7193:Brpf3 UTSW 17 29,055,665 (GRCm39) makesense probably null
R7316:Brpf3 UTSW 17 29,033,660 (GRCm39) missense probably damaging 1.00
R7326:Brpf3 UTSW 17 29,025,267 (GRCm39) missense probably benign 0.00
R7403:Brpf3 UTSW 17 29,040,330 (GRCm39) missense probably benign
R7666:Brpf3 UTSW 17 29,029,546 (GRCm39) missense possibly damaging 0.83
R7686:Brpf3 UTSW 17 29,025,908 (GRCm39) missense probably damaging 0.98
R7691:Brpf3 UTSW 17 29,025,805 (GRCm39) missense probably damaging 1.00
R8054:Brpf3 UTSW 17 29,055,571 (GRCm39) missense probably damaging 1.00
R8165:Brpf3 UTSW 17 29,025,248 (GRCm39) missense probably benign 0.01
R8200:Brpf3 UTSW 17 29,025,248 (GRCm39) missense probably benign 0.01
R8698:Brpf3 UTSW 17 29,037,436 (GRCm39) missense probably damaging 0.99
R8722:Brpf3 UTSW 17 29,029,510 (GRCm39) missense probably benign 0.42
R8738:Brpf3 UTSW 17 29,040,214 (GRCm39) missense probably benign
R9044:Brpf3 UTSW 17 29,025,871 (GRCm39) missense possibly damaging 0.90
R9250:Brpf3 UTSW 17 29,054,788 (GRCm39) missense probably damaging 1.00
R9349:Brpf3 UTSW 17 29,040,276 (GRCm39) missense probably benign 0.00
R9496:Brpf3 UTSW 17 29,040,453 (GRCm39) missense probably benign
R9564:Brpf3 UTSW 17 29,026,152 (GRCm39) missense probably benign
R9649:Brpf3 UTSW 17 29,037,597 (GRCm39) missense probably benign
R9720:Brpf3 UTSW 17 29,026,330 (GRCm39) missense probably benign 0.13
Z1177:Brpf3 UTSW 17 29,040,452 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGATTCAAAATTGCCTGCCCCAC -3'
(R):5'- CGGGAATAGTGTTCATCCTCTGTGC -3'

Sequencing Primer
(F):5'- TTCCTTGTCAGAACAGGAATCC -3'
(R):5'- GACCCCTCTGTAGCTTAACTC -3'
Posted On 2014-05-23