Incidental Mutation 'R1745:Capn3'
ID193905
Institutional Source Beutler Lab
Gene Symbol Capn3
Ensembl Gene ENSMUSG00000079110
Gene Namecalpain 3
SynonymsCapa-3, Capa3, Lp82, p94
MMRRC Submission 039777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R1745 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120456019-120504913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120489689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 283 (V283M)
Ref Sequence ENSEMBL: ENSMUSP00000087482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028748] [ENSMUST00000028749] [ENSMUST00000090028] [ENSMUST00000110716] [ENSMUST00000110719] [ENSMUST00000110721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028748
AA Change: V283M

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028748
Gene: ENSMUSG00000079110
AA Change: V283M

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
EFh 584 612 5.53e-4 SMART
EFh 614 642 1.8e-3 SMART
EFh 679 707 4.32e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000028749
AA Change: V351M

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028749
Gene: ENSMUSG00000079110
AA Change: V351M

DomainStartEndE-ValueType
CysPc 56 425 2.09e-212 SMART
calpain_III 428 582 4.27e-90 SMART
Pfam:Calpain_u2 583 653 1.3e-31 PFAM
EFh 696 724 5.53e-4 SMART
EFh 726 754 1.8e-3 SMART
EFh 791 819 4.32e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090028
AA Change: V283M

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087482
Gene: ENSMUSG00000079110
AA Change: V283M

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
low complexity region 585 599 N/A INTRINSIC
EFh 612 640 5.53e-4 SMART
EFh 642 670 1.8e-3 SMART
EFh 707 735 4.32e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110716
AA Change: V331M

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106344
Gene: ENSMUSG00000079110
AA Change: V331M

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
EFh 632 660 5.53e-4 SMART
EFh 662 690 1.8e-3 SMART
EFh 727 755 4.32e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110719
AA Change: V331M

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106347
Gene: ENSMUSG00000079110
AA Change: V331M

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
low complexity region 633 647 N/A INTRINSIC
EFh 660 688 5.53e-4 SMART
EFh 690 718 1.8e-3 SMART
EFh 755 783 4.32e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110721
AA Change: V303M

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106349
Gene: ENSMUSG00000079110
AA Change: V303M

DomainStartEndE-ValueType
CysPc 56 377 1.13e-208 SMART
calpain_III 380 534 4.27e-90 SMART
EFh 604 632 5.53e-4 SMART
EFh 634 662 1.8e-3 SMART
EFh 699 727 4.32e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145993
Meta Mutation Damage Score 0.2991 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in muscle dystrophy. The psoas, soleus, and deltoid muscles are the most severely affected. The mutant allele appears to be preferentially transmitted resulting in ratio distortion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,723 S245P probably benign Het
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gad1-ps A T 10: 99,445,524 noncoding transcript Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Kmt2b A T 7: 30,585,850 M539K possibly damaging Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Med15 G A 16: 17,655,706 probably benign Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
N4bp2l2 A T 5: 150,661,959 N185K probably benign Het
Nkx2-1 A G 12: 56,533,744 M137T probably benign Het
Olfr638 A G 7: 104,004,063 T269A probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rnf44 G A 13: 54,682,192 R271W probably damaging Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Tnfsf13 G A 11: 69,685,147 A38V probably benign Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in Capn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Capn3 APN 2 120486482 intron probably benign
IGL00976:Capn3 APN 2 120491901 missense possibly damaging 0.81
IGL01538:Capn3 APN 2 120502186 splice site probably null
IGL01564:Capn3 APN 2 120480708 missense probably damaging 1.00
IGL02527:Capn3 APN 2 120504485 missense probably damaging 0.99
IGL02605:Capn3 APN 2 120496037 missense probably damaging 0.98
IGL02678:Capn3 APN 2 120502998 missense probably damaging 1.00
IGL02899:Capn3 APN 2 120491901 missense possibly damaging 0.81
IGL03255:Capn3 APN 2 120489708 missense probably damaging 1.00
R0053:Capn3 UTSW 2 120491837 missense possibly damaging 0.95
R0053:Capn3 UTSW 2 120491837 missense possibly damaging 0.95
R0096:Capn3 UTSW 2 120502529 missense possibly damaging 0.94
R0096:Capn3 UTSW 2 120502529 missense possibly damaging 0.94
R0276:Capn3 UTSW 2 120488065 splice site probably benign
R0601:Capn3 UTSW 2 120502596 splice site probably null
R0714:Capn3 UTSW 2 120491880 missense probably benign 0.32
R1217:Capn3 UTSW 2 120486421 nonsense probably null
R1530:Capn3 UTSW 2 120482208 missense probably damaging 1.00
R1566:Capn3 UTSW 2 120502993 missense possibly damaging 0.72
R1748:Capn3 UTSW 2 120497013 missense probably benign 0.10
R1861:Capn3 UTSW 2 120486482 intron probably benign
R1960:Capn3 UTSW 2 120463940 missense probably benign 0.00
R1971:Capn3 UTSW 2 120480747 missense possibly damaging 0.95
R1994:Capn3 UTSW 2 120495937 missense probably damaging 1.00
R2043:Capn3 UTSW 2 120491901 missense possibly damaging 0.81
R2254:Capn3 UTSW 2 120501251 missense probably benign 0.01
R2255:Capn3 UTSW 2 120501251 missense probably benign 0.01
R3738:Capn3 UTSW 2 120485287 missense possibly damaging 0.85
R3824:Capn3 UTSW 2 120484483 splice site probably benign
R4796:Capn3 UTSW 2 120502998 missense probably damaging 1.00
R5073:Capn3 UTSW 2 120491820 missense probably damaging 1.00
R5116:Capn3 UTSW 2 120485292 missense probably benign 0.00
R5152:Capn3 UTSW 2 120501330 intron probably benign
R5420:Capn3 UTSW 2 120495296 intron probably benign
R5478:Capn3 UTSW 2 120464185 splice site probably null
R5506:Capn3 UTSW 2 120502420 missense probably damaging 0.97
R5664:Capn3 UTSW 2 120477025 missense probably benign 0.04
R5733:Capn3 UTSW 2 120484594 nonsense probably null
R6212:Capn3 UTSW 2 120477186 missense probably benign 0.17
R7176:Capn3 UTSW 2 120504492 missense possibly damaging 0.46
R7219:Capn3 UTSW 2 120503454 missense probably damaging 0.99
R7365:Capn3 UTSW 2 120494814 missense probably damaging 0.98
R7819:Capn3 UTSW 2 120464165 missense probably benign 0.05
R8052:Capn3 UTSW 2 120486386 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAAGCTTCTGGTTTGTCCACCTG -3'
(R):5'- GCACCATCATGTTCACTGAGTCCC -3'

Sequencing Primer
(F):5'- ATCAGATGCCCCATCTTTCC -3'
(R):5'- TTTTGGGGAACCCACACC -3'
Posted On2014-05-23