Incidental Mutation 'R1745:Kmt2b'
ID193923
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Namelysine (K)-specific methyltransferase 2B
Synonyms2610014H22Rik, Wbp7, Mll2
MMRRC Submission 039777-MU
Accession Numbers

Genbank: NM_029274; MGI: 109565

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1745 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30568858-30588726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30585850 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 539 (M539K)
Ref Sequence ENSEMBL: ENSMUSP00000103789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108150] [ENSMUST00000108151] [ENSMUST00000108154]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006470
AA Change: M539K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307
AA Change: M539K

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108150
SMART Domains Protein: ENSMUSP00000103785
Gene: ENSMUSG00000006310

DomainStartEndE-ValueType
ZnF_C2H2 14 36 1.67e-2 SMART
ZnF_C2H2 41 63 2.4e-3 SMART
low complexity region 81 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108151
SMART Domains Protein: ENSMUSP00000103786
Gene: ENSMUSG00000006310

DomainStartEndE-ValueType
BTB 29 117 1.67e-8 SMART
low complexity region 207 222 N/A INTRINSIC
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 1.67e-2 SMART
ZnF_C2H2 405 427 2.4e-3 SMART
low complexity region 445 465 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108154
AA Change: M539K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307
AA Change: M539K

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125372
Predicted Effect probably benign
Transcript: ENSMUST00000131002
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185080
Meta Mutation Damage Score 0.1387 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,723 S245P probably benign Het
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Capn3 G A 2: 120,489,689 V283M possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gad1-ps A T 10: 99,445,524 noncoding transcript Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Med15 G A 16: 17,655,706 probably benign Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
N4bp2l2 A T 5: 150,661,959 N185K probably benign Het
Nkx2-1 A G 12: 56,533,744 M137T probably benign Het
Olfr638 A G 7: 104,004,063 T269A probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rnf44 G A 13: 54,682,192 R271W probably damaging Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Tnfsf13 G A 11: 69,685,147 A38V probably benign Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30586513 unclassified probably benign
IGL00821:Kmt2b APN 7 30570613 missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30579927 missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30580507 missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30569514 critical splice donor site probably null
IGL01949:Kmt2b APN 7 30577161 splice site probably null
IGL02253:Kmt2b APN 7 30581727 missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30578878 critical splice donor site probably null
IGL02493:Kmt2b APN 7 30569511 unclassified probably benign
IGL02504:Kmt2b APN 7 30586543 unclassified probably benign
IGL02532:Kmt2b APN 7 30586889 unclassified probably benign
IGL02698:Kmt2b APN 7 30578693 splice site probably benign
IGL02717:Kmt2b APN 7 30583444 missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30577144 missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30575462 missense probably benign 0.02
IGL03386:Kmt2b APN 7 30573971 missense possibly damaging 0.94
ivoire UTSW 7 30584559 missense probably damaging 0.98
3-1:Kmt2b UTSW 7 30569615 nonsense probably null
FR4304:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4342:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4548:Kmt2b UTSW 7 30586380 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586364 nonsense probably null
FR4589:Kmt2b UTSW 7 30586381 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586367 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586370 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586378 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586360 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586362 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586364 nonsense probably null
FR4976:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586373 unclassified probably benign
PIT4403001:Kmt2b UTSW 7 30585689 missense probably damaging 1.00
PIT4802001:Kmt2b UTSW 7 30579571 missense probably damaging 0.99
R0057:Kmt2b UTSW 7 30576792 splice site probably benign
R0131:Kmt2b UTSW 7 30583921 missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30574193 missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30576755 missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30574940 missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30580487 missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30576960 splice site probably benign
R1599:Kmt2b UTSW 7 30570575 missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30583962 missense probably damaging 1.00
R1867:Kmt2b UTSW 7 30574658 missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30575351 missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30569420 missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30583387 missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30574065 missense probably benign 0.25
R2401:Kmt2b UTSW 7 30576708 missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30576068 missense probably benign 0.10
R3436:Kmt2b UTSW 7 30576692 missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30574064 missense probably benign 0.25
R4259:Kmt2b UTSW 7 30581081 missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30581836 critical splice donor site probably null
R4388:Kmt2b UTSW 7 30588590 unclassified probably benign
R4542:Kmt2b UTSW 7 30580259 missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30586358 unclassified probably benign
R4722:Kmt2b UTSW 7 30583202 missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30576761 nonsense probably null
R4916:Kmt2b UTSW 7 30578517 missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30569840 missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30569175 missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30569794 missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30581673 missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30580444 missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30577145 missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30588477 unclassified probably benign
R6727:Kmt2b UTSW 7 30584559 missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30586276 unclassified probably benign
R7048:Kmt2b UTSW 7 30569306 missense probably damaging 0.99
R7155:Kmt2b UTSW 7 30579963 missense probably damaging 0.99
R7307:Kmt2b UTSW 7 30580471 missense probably damaging 0.99
R7388:Kmt2b UTSW 7 30581960 missense probably damaging 1.00
R7555:Kmt2b UTSW 7 30569410 missense possibly damaging 0.83
R7569:Kmt2b UTSW 7 30569553 missense possibly damaging 0.54
R7616:Kmt2b UTSW 7 30582208 missense probably damaging 1.00
R7669:Kmt2b UTSW 7 30583231 missense possibly damaging 0.84
R7881:Kmt2b UTSW 7 30579783 missense probably damaging 1.00
R7964:Kmt2b UTSW 7 30579783 missense probably damaging 1.00
R7999:Kmt2b UTSW 7 30576774 missense probably damaging 1.00
R8003:Kmt2b UTSW 7 30569377 missense probably damaging 0.98
R8189:Kmt2b UTSW 7 30569331 missense not run
RF001:Kmt2b UTSW 7 30586382 unclassified probably benign
RF006:Kmt2b UTSW 7 30586377 unclassified probably benign
RF020:Kmt2b UTSW 7 30586382 unclassified probably benign
RF021:Kmt2b UTSW 7 30586357 unclassified probably benign
RF030:Kmt2b UTSW 7 30586377 unclassified probably benign
RF035:Kmt2b UTSW 7 30586357 unclassified probably benign
X0067:Kmt2b UTSW 7 30579573 missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30585251 missense probably benign 0.28
Z1176:Kmt2b UTSW 7 30577370 missense probably damaging 1.00
Z1177:Kmt2b UTSW 7 30575024 missense probably benign 0.08
Z1177:Kmt2b UTSW 7 30584163 missense probably damaging 0.98
Z1177:Kmt2b UTSW 7 30586416 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGCGAAATGTGGGTTCCCTTAG -3'
(R):5'- AAAGCTTCCGTCACCACCCTTG -3'

Sequencing Primer
(F):5'- AGGATAGACCGCCTCTTCTCAG -3'
(R):5'- tcccttcaccacctcctc -3'
Posted On2014-05-23