Incidental Mutation 'R1745:Olfr638'
ID193928
Institutional Source Beutler Lab
Gene Symbol Olfr638
Ensembl Gene ENSMUSG00000094063
Gene Nameolfactory receptor 638
SynonymsMOR5-1, GA_x6K02T2PBJ9-6737723-6738670
MMRRC Submission 039777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R1745 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103998746-104004357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104004063 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 269 (T269A)
Ref Sequence ENSEMBL: ENSMUSP00000148160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138055] [ENSMUST00000209757] [ENSMUST00000215653] [ENSMUST00000218325]
Predicted Effect probably benign
Transcript: ENSMUST00000098184
AA Change: T269A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000095786
Gene: ENSMUSG00000094063
AA Change: T269A

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 2.6e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 198 9.8e-10 PFAM
Pfam:7tm_1 49 300 7.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209757
AA Change: T269A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000215653
Predicted Effect probably benign
Transcript: ENSMUST00000218325
AA Change: T263A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.2522 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,723 S245P probably benign Het
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Capn3 G A 2: 120,489,689 V283M possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gad1-ps A T 10: 99,445,524 noncoding transcript Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Kmt2b A T 7: 30,585,850 M539K possibly damaging Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Med15 G A 16: 17,655,706 probably benign Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
N4bp2l2 A T 5: 150,661,959 N185K probably benign Het
Nkx2-1 A G 12: 56,533,744 M137T probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rnf44 G A 13: 54,682,192 R271W probably damaging Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Tnfsf13 G A 11: 69,685,147 A38V probably benign Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in Olfr638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Olfr638 APN 7 104003635 missense probably damaging 1.00
IGL01901:Olfr638 APN 7 104004067 missense probably damaging 1.00
IGL02040:Olfr638 APN 7 104003407 missense probably damaging 1.00
IGL02756:Olfr638 APN 7 104003659 missense probably damaging 1.00
R0122:Olfr638 UTSW 7 104003358 missense probably damaging 1.00
R0137:Olfr638 UTSW 7 104003502 missense probably benign 0.13
R0312:Olfr638 UTSW 7 104004025 missense probably damaging 1.00
R0650:Olfr638 UTSW 7 104003239 splice site probably null
R0652:Olfr638 UTSW 7 104003239 splice site probably null
R1382:Olfr638 UTSW 7 104003720 missense probably benign 0.01
R1700:Olfr638 UTSW 7 104004122 nonsense probably null
R1723:Olfr638 UTSW 7 104003311 missense probably damaging 0.97
R1840:Olfr638 UTSW 7 104004117 missense probably benign 0.00
R3408:Olfr638 UTSW 7 104003343 nonsense probably null
R3413:Olfr638 UTSW 7 104003832 missense probably damaging 0.99
R4441:Olfr638 UTSW 7 104004072 missense probably damaging 1.00
R4727:Olfr638 UTSW 7 104003890 missense probably benign 0.00
R5096:Olfr638 UTSW 7 104003460 missense probably benign 0.08
R5851:Olfr638 UTSW 7 104003452 missense probably benign 0.13
R6133:Olfr638 UTSW 7 104003325 missense possibly damaging 0.58
R6529:Olfr638 UTSW 7 104003926 missense probably benign 0.06
R6572:Olfr638 UTSW 7 103999184 intron probably null
R6799:Olfr638 UTSW 7 103998799 critical splice donor site probably null
R7267:Olfr638 UTSW 7 104003839 missense probably benign
X0018:Olfr638 UTSW 7 104003431 missense probably benign
X0063:Olfr638 UTSW 7 104003527 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCAGGTCCTCTGGTTCAACATTC -3'
(R):5'- GCACCTTTCTTTGCAACAGGAGGC -3'

Sequencing Primer
(F):5'- CAACAGATGGTACGGATTTGCTC -3'
(R):5'- AGGCGAGTAATTCCTTGACG -3'
Posted On2014-05-23