Mutagenetix > Incidental Mutation

Incidental Mutation 'R1745:Atp2c2'

193933

Institutional Source

Beutler Lab

Gene Symbol

Atp2c2

Ensembl Gene

ENSMUSG00000034112

Gene Name

ATPase, Ca++ transporting, type 2C, member 2

Synonyms

MMRRC Submission

039777-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119700009-119757717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119725094 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 133 (V133I)

Ref Sequence

ENSEMBL: ENSMUSP00000148585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]

AlphaFold

A7L9Z8

Predicted Effect

probably benign
Transcript: ENSMUST00000095171
AA Change: V133I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: V133I

Domain	Start	End	E-Value	Type
Cation_ATPase_N	54	128	1.27e-12	SMART
Pfam:E1-E2_ATPase	133	366	1.7e-62	PFAM
Pfam:Hydrolase	371	684	5.3e-18	PFAM
Pfam:HAD	374	681	7.4e-11	PFAM
Pfam:Cation_ATPase	437	521	1.1e-17	PFAM
Pfam:Cation_ATPase_C	754	927	1.1e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212454
AA Change: V133I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

Meta Mutation Damage Score

0.0842

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	A	G	11: 29,824,723	S245P	probably benign	Het
Abcc10	A	T	17: 46,312,433	V851E	probably benign	Het
Adam28	A	G	14: 68,633,171	I351T	probably benign	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Ap2a1	T	C	7: 44,906,945	E285G	probably damaging	Het
Arfgef1	A	C	1: 10,173,255	I1023R	probably damaging	Het
Bpifb6	A	G	2: 153,911,483	T401A	possibly damaging	Het
Capn3	G	A	2: 120,489,689	V283M	possibly damaging	Het
Chd6	A	T	2: 160,981,667	V1261E	probably damaging	Het
Col22a1	C	T	15: 72,006,787	A174T	probably damaging	Het
Crnn	T	C	3: 93,146,891	V27A	probably benign	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dgkd	T	C	1: 87,932,044		probably null	Het
Diaph3	A	G	14: 86,966,560	L554P	probably damaging	Het
Ephb4	A	T	5: 137,360,434	H293L	probably benign	Het
Erbin	G	T	13: 103,839,449	H646N	probably damaging	Het
Faiml	T	C	9: 99,234,458	N60D	probably benign	Het
Flot1	A	G	17: 35,824,660	E102G	probably damaging	Het
Fryl	G	A	5: 73,032,861		probably benign	Het
Gad1-ps	A	T	10: 99,445,524		noncoding transcript	Het
Gtf3c3	A	G	1: 54,434,212	S81P	probably damaging	Het
Hs1bp3	C	T	12: 8,321,690	Q91*	probably null	Het
Igf1r	T	C	7: 68,169,913	C324R	probably damaging	Het
Il23r	G	A	6: 67,466,291	T276I	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Kctd1	A	T	18: 15,063,206		probably benign	Het
Kmt2b	A	T	7: 30,585,850	M539K	possibly damaging	Het
Man2b1	T	A	8: 85,093,934	F617I	probably damaging	Het
Med15	G	A	16: 17,655,706		probably benign	Het
Myo9b	A	G	8: 71,354,047	K1543R	probably damaging	Het
N4bp2	A	G	5: 65,790,822	Y265C	probably benign	Het
N4bp2l2	A	T	5: 150,661,959	N185K	probably benign	Het
Nkx2-1	A	G	12: 56,533,744	M137T	probably benign	Het
Olfr638	A	G	7: 104,004,063	T269A	probably benign	Het
Prickle2	A	T	6: 92,376,593	Y631N	probably damaging	Het
Ptpro	A	G	6: 137,400,645	T698A	probably benign	Het
Rapgef3	T	C	15: 97,750,178	I690V	probably benign	Het
Rnf44	G	A	13: 54,682,192	R271W	probably damaging	Het
Rundc3a	GAGCC	GAGCCAGCC	11: 102,400,913		probably null	Het
Ryr2	A	G	13: 11,790,267	Y904H	probably damaging	Het
Suz12	T	C	11: 80,022,096	L322P	probably damaging	Het
Tnfsf13	G	A	11: 69,685,147	A38V	probably benign	Het
Topbp1	G	A	9: 103,308,845	R62H	probably benign	Het
Tor1aip1	G	T	1: 156,030,434		probably null	Het
Trpv4	A	T	5: 114,633,154	V438E	probably damaging	Het
Tsku	A	T	7: 98,352,179	V315E	possibly damaging	Het
Ttc38	T	C	15: 85,833,172	L16P	probably damaging	Het
Vmn1r170	A	G	7: 23,606,334	I54V	probably damaging	Het
Vmn1r71	T	C	7: 10,748,269	D98G	probably benign	Het
Wdfy3	A	T	5: 101,948,929	D334E	probably damaging	Het
Zfhx3	T	A	8: 108,955,862	F3311Y	unknown	Het
Zswim9	A	G	7: 13,269,556	S123P	probably damaging	Het

Other mutations in Atp2c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Atp2c2	APN	8	119745590	missense	probably benign
IGL01624:Atp2c2	APN	8	119757450	missense	probably benign	0.00
IGL02133:Atp2c2	APN	8	119754335	missense	probably benign	0.00
IGL02221:Atp2c2	APN	8	119744334	missense	probably damaging	1.00
IGL02606:Atp2c2	APN	8	119730274	missense	probably benign
IGL02657:Atp2c2	APN	8	119753032	missense	probably damaging	1.00
IGL02839:Atp2c2	APN	8	119749120	missense	possibly damaging	0.85
IGL03122:Atp2c2	APN	8	119742675	missense	possibly damaging	0.77
R0031:Atp2c2	UTSW	8	119749062	missense	probably benign	0.15
R0372:Atp2c2	UTSW	8	119757441	missense	probably benign
R0502:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0503:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0584:Atp2c2	UTSW	8	119738418	missense	probably benign	0.01
R1225:Atp2c2	UTSW	8	119735245	missense	probably damaging	1.00
R1580:Atp2c2	UTSW	8	119752987	missense	probably benign	0.00
R1620:Atp2c2	UTSW	8	119749126	missense	probably benign
R1638:Atp2c2	UTSW	8	119756003	missense	possibly damaging	0.82
R1746:Atp2c2	UTSW	8	119734443	unclassified	probably benign
R1907:Atp2c2	UTSW	8	119749876	splice site	probably benign
R2104:Atp2c2	UTSW	8	119749845	missense	probably benign
R2151:Atp2c2	UTSW	8	119756102	missense	probably benign
R2152:Atp2c2	UTSW	8	119756102	missense	probably benign
R2154:Atp2c2	UTSW	8	119756102	missense	probably benign
R2207:Atp2c2	UTSW	8	119748309	missense	probably damaging	1.00
R3874:Atp2c2	UTSW	8	119735296	missense	possibly damaging	0.74
R3912:Atp2c2	UTSW	8	119721276	missense	probably damaging	1.00
R4093:Atp2c2	UTSW	8	119749871	critical splice donor site	probably null
R4782:Atp2c2	UTSW	8	119749152	missense	probably damaging	0.97
R4801:Atp2c2	UTSW	8	119747687	missense	probably damaging	1.00
R4973:Atp2c2	UTSW	8	119754263	missense	probably benign	0.00
R5485:Atp2c2	UTSW	8	119753062	critical splice donor site	probably null
R5978:Atp2c2	UTSW	8	119749875	splice site	probably null
R6377:Atp2c2	UTSW	8	119726354	missense	probably benign	0.10
R6613:Atp2c2	UTSW	8	119756021	missense	probably damaging	0.99
R6765:Atp2c2	UTSW	8	119753017	missense	probably damaging	1.00
R6836:Atp2c2	UTSW	8	119734415	missense	probably damaging	1.00
R6963:Atp2c2	UTSW	8	119730267	nonsense	probably null
R7220:Atp2c2	UTSW	8	119745561	missense	probably benign	0.00
R7238:Atp2c2	UTSW	8	119742421	missense	possibly damaging	0.73
R7373:Atp2c2	UTSW	8	119730252	missense	probably benign	0.02
R7438:Atp2c2	UTSW	8	119748197	missense	probably damaging	1.00
R7573:Atp2c2	UTSW	8	119751269	missense	probably damaging	1.00
R7677:Atp2c2	UTSW	8	119748176	missense	probably benign	0.00
R7737:Atp2c2	UTSW	8	119742395	missense	probably damaging	1.00
R7912:Atp2c2	UTSW	8	119730178	missense	possibly damaging	0.81
R8821:Atp2c2	UTSW	8	119749294	splice site	probably null
R8831:Atp2c2	UTSW	8	119749294	splice site	probably null
R9200:Atp2c2	UTSW	8	119748260	nonsense	probably null
R9211:Atp2c2	UTSW	8	119719293	missense	probably benign
R9246:Atp2c2	UTSW	8	119730250	missense	probably damaging	1.00
R9285:Atp2c2	UTSW	8	119738402	missense	probably benign	0.00
RF004:Atp2c2	UTSW	8	119752822	missense	probably damaging	1.00
RF012:Atp2c2	UTSW	8	119745514	missense	possibly damaging	0.91
Z1177:Atp2c2	UTSW	8	119734385	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCCCACAAGTCTGTCAATGGTG -3'
(R):5'- GGTGCCTGAAAATGAGGTTGTCCTG -3'

Sequencing Primer
(F):5'- TAATGGATTGAGCAGTCCCC -3'
(R):5'- AGGTTGTCCTGTAGCCTCTG -3'

Posted On

2014-05-23