Incidental Mutation 'R1745:Gad1-ps'
ID193937
Institutional Source Beutler Lab
Gene Symbol Gad1-ps
Ensembl Gene ENSMUSG00000090665
Gene Nameglutamate decarboxylase 1, pseudogene
SynonymsGad-1ps
MMRRC Submission 039777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R1745 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99443838-99447029 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 99445524 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167243
SMART Domains Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 1 368 4.3e-153 PFAM
Pfam:Beta_elim_lyase 91 436 7.3e-8 PFAM
Pfam:Aminotran_5 130 370 4.7e-7 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,723 S245P probably benign Het
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Capn3 G A 2: 120,489,689 V283M possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Kmt2b A T 7: 30,585,850 M539K possibly damaging Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Med15 G A 16: 17,655,706 probably benign Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
N4bp2l2 A T 5: 150,661,959 N185K probably benign Het
Nkx2-1 A G 12: 56,533,744 M137T probably benign Het
Olfr638 A G 7: 104,004,063 T269A probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rnf44 G A 13: 54,682,192 R271W probably damaging Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Tnfsf13 G A 11: 69,685,147 A38V probably benign Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in Gad1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Gad1-ps APN 10 99445448 exon noncoding transcript
IGL01301:Gad1-ps APN 10 99445151 exon noncoding transcript
IGL01394:Gad1-ps APN 10 99445562 exon noncoding transcript
IGL02220:Gad1-ps APN 10 99445322 exon noncoding transcript
IGL02240:Gad1-ps APN 10 99444958 exon noncoding transcript
IGL03406:Gad1-ps APN 10 99444779 exon noncoding transcript
ANU18:Gad1-ps UTSW 10 99445151 exon noncoding transcript
R0305:Gad1-ps UTSW 10 99444803 exon noncoding transcript
R0446:Gad1-ps UTSW 10 99445521 exon noncoding transcript
R0538:Gad1-ps UTSW 10 99444992 exon noncoding transcript
R1511:Gad1-ps UTSW 10 99445469 exon noncoding transcript
R1734:Gad1-ps UTSW 10 99445775 exon noncoding transcript
R1886:Gad1-ps UTSW 10 99445582 exon noncoding transcript
R3111:Gad1-ps UTSW 10 99444521 exon noncoding transcript
R3617:Gad1-ps UTSW 10 99445398 exon noncoding transcript
R5042:Gad1-ps UTSW 10 99445654 exon noncoding transcript
R5223:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5234:Gad1-ps UTSW 10 99445326 exon noncoding transcript
R5275:Gad1-ps UTSW 10 99444889 exon noncoding transcript
R5295:Gad1-ps UTSW 10 99444889 exon noncoding transcript
R5334:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5335:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5336:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5337:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5396:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5397:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5399:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5428:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5429:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5431:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5661:Gad1-ps UTSW 10 99445039 exon noncoding transcript
R5667:Gad1-ps UTSW 10 99444533 exon noncoding transcript
R5671:Gad1-ps UTSW 10 99444533 exon noncoding transcript
R5885:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5886:Gad1-ps UTSW 10 99445147 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AAGATAATGGGCGTACCGCTCCAG -3'
(R):5'- GGAAGAAGTTCACCTTGTCCCCTTG -3'

Sequencing Primer
(F):5'- TATGCTCCAAGGATGCAGC -3'
(R):5'- TTGAGGCTGGTAGCCCAC -3'
Posted On2014-05-23