Incidental Mutation 'R1745:Gad1-ps'
ID 193937
Institutional Source Beutler Lab
Gene Symbol Gad1-ps
Ensembl Gene ENSMUSG00000090665
Gene Name glutamate decarboxylase 1, pseudogene
Synonyms Gad-1ps
MMRRC Submission 039777-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.208) question?
Stock # R1745 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 99279906-99281681 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) A to T at 99281386 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167243
SMART Domains Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 1 368 4.3e-153 PFAM
Pfam:Beta_elim_lyase 91 436 7.3e-8 PFAM
Pfam:Aminotran_5 130 370 4.7e-7 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,623,359 (GRCm39) V851E probably benign Het
Adam28 A G 14: 68,870,620 (GRCm39) I351T probably benign Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Ap2a1 T C 7: 44,556,369 (GRCm39) E285G probably damaging Het
Arfgef1 A C 1: 10,243,480 (GRCm39) I1023R probably damaging Het
Atp2c2 G A 8: 120,451,833 (GRCm39) V133I probably benign Het
Bpifb6 A G 2: 153,753,403 (GRCm39) T401A possibly damaging Het
Capn3 G A 2: 120,320,170 (GRCm39) V283M possibly damaging Het
Chd6 A T 2: 160,823,587 (GRCm39) V1261E probably damaging Het
Col22a1 C T 15: 71,878,636 (GRCm39) A174T probably damaging Het
Crnn T C 3: 93,054,198 (GRCm39) V27A probably benign Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dgkd T C 1: 87,859,766 (GRCm39) probably null Het
Diaph3 A G 14: 87,203,996 (GRCm39) L554P probably damaging Het
Ephb4 A T 5: 137,358,696 (GRCm39) H293L probably benign Het
Erbin G T 13: 103,975,957 (GRCm39) H646N probably damaging Het
Faiml T C 9: 99,116,511 (GRCm39) N60D probably benign Het
Fem1al A G 11: 29,774,723 (GRCm39) S245P probably benign Het
Flot1 A G 17: 36,135,552 (GRCm39) E102G probably damaging Het
Fryl G A 5: 73,190,204 (GRCm39) probably benign Het
Gtf3c3 A G 1: 54,473,371 (GRCm39) S81P probably damaging Het
Hs1bp3 C T 12: 8,371,690 (GRCm39) Q91* probably null Het
Igf1r T C 7: 67,819,661 (GRCm39) C324R probably damaging Het
Il23r G A 6: 67,443,275 (GRCm39) T276I probably damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Kctd1 A T 18: 15,196,263 (GRCm39) probably benign Het
Kmt2b A T 7: 30,285,275 (GRCm39) M539K possibly damaging Het
Man2b1 T A 8: 85,820,563 (GRCm39) F617I probably damaging Het
Med15 G A 16: 17,473,570 (GRCm39) probably benign Het
Myo9b A G 8: 71,806,691 (GRCm39) K1543R probably damaging Het
N4bp2 A G 5: 65,948,165 (GRCm39) Y265C probably benign Het
N4bp2l2 A T 5: 150,585,424 (GRCm39) N185K probably benign Het
Nkx2-1 A G 12: 56,580,529 (GRCm39) M137T probably benign Het
Or51q1c A G 7: 103,653,270 (GRCm39) T269A probably benign Het
Prickle2 A T 6: 92,353,574 (GRCm39) Y631N probably damaging Het
Ptpro A G 6: 137,377,643 (GRCm39) T698A probably benign Het
Rapgef3 T C 15: 97,648,059 (GRCm39) I690V probably benign Het
Rnf44 G A 13: 54,830,005 (GRCm39) R271W probably damaging Het
Rundc3a GAGCC GAGCCAGCC 11: 102,291,739 (GRCm39) probably null Het
Ryr2 A G 13: 11,805,153 (GRCm39) Y904H probably damaging Het
Suz12 T C 11: 79,912,922 (GRCm39) L322P probably damaging Het
Tnfsf13 G A 11: 69,575,973 (GRCm39) A38V probably benign Het
Topbp1 G A 9: 103,186,044 (GRCm39) R62H probably benign Het
Tor1aip1 G T 1: 155,906,180 (GRCm39) probably null Het
Trpv4 A T 5: 114,771,215 (GRCm39) V438E probably damaging Het
Tsku A T 7: 98,001,386 (GRCm39) V315E possibly damaging Het
Ttc38 T C 15: 85,717,373 (GRCm39) L16P probably damaging Het
Vmn1r170 A G 7: 23,305,759 (GRCm39) I54V probably damaging Het
Vmn1r71 T C 7: 10,482,196 (GRCm39) D98G probably benign Het
Wdfy3 A T 5: 102,096,795 (GRCm39) D334E probably damaging Het
Zfhx3 T A 8: 109,682,494 (GRCm39) F3311Y unknown Het
Zswim9 A G 7: 13,003,482 (GRCm39) S123P probably damaging Het
Other mutations in Gad1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Gad1-ps APN 10 99,281,310 (GRCm39) exon noncoding transcript
IGL01301:Gad1-ps APN 10 99,281,013 (GRCm39) exon noncoding transcript
IGL01394:Gad1-ps APN 10 99,281,424 (GRCm39) exon noncoding transcript
IGL02220:Gad1-ps APN 10 99,281,184 (GRCm39) exon noncoding transcript
IGL02240:Gad1-ps APN 10 99,280,820 (GRCm39) exon noncoding transcript
IGL03406:Gad1-ps APN 10 99,280,641 (GRCm39) exon noncoding transcript
ANU18:Gad1-ps UTSW 10 99,281,013 (GRCm39) exon noncoding transcript
R0305:Gad1-ps UTSW 10 99,280,665 (GRCm39) exon noncoding transcript
R0446:Gad1-ps UTSW 10 99,281,383 (GRCm39) exon noncoding transcript
R0538:Gad1-ps UTSW 10 99,280,854 (GRCm39) exon noncoding transcript
R1511:Gad1-ps UTSW 10 99,281,331 (GRCm39) exon noncoding transcript
R1734:Gad1-ps UTSW 10 99,281,637 (GRCm39) exon noncoding transcript
R1886:Gad1-ps UTSW 10 99,281,444 (GRCm39) exon noncoding transcript
R3111:Gad1-ps UTSW 10 99,280,383 (GRCm39) exon noncoding transcript
R3617:Gad1-ps UTSW 10 99,281,260 (GRCm39) exon noncoding transcript
R5042:Gad1-ps UTSW 10 99,281,516 (GRCm39) exon noncoding transcript
R5223:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5234:Gad1-ps UTSW 10 99,281,188 (GRCm39) exon noncoding transcript
R5275:Gad1-ps UTSW 10 99,280,751 (GRCm39) exon noncoding transcript
R5295:Gad1-ps UTSW 10 99,280,751 (GRCm39) exon noncoding transcript
R5334:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5335:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5336:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5337:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5396:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5397:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5399:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5428:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5429:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5431:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5661:Gad1-ps UTSW 10 99,280,901 (GRCm39) exon noncoding transcript
R5667:Gad1-ps UTSW 10 99,280,395 (GRCm39) exon noncoding transcript
R5671:Gad1-ps UTSW 10 99,280,395 (GRCm39) exon noncoding transcript
R5885:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5886:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AAGATAATGGGCGTACCGCTCCAG -3'
(R):5'- GGAAGAAGTTCACCTTGTCCCCTTG -3'

Sequencing Primer
(F):5'- TATGCTCCAAGGATGCAGC -3'
(R):5'- TTGAGGCTGGTAGCCCAC -3'
Posted On 2014-05-23