Incidental Mutation 'R1745:Tnfsf13'
ID193939
Institutional Source Beutler Lab
Gene Symbol Tnfsf13
Ensembl Gene ENSMUSG00000089669
Gene Nametumor necrosis factor (ligand) superfamily, member 13
SynonymsAPRIL, 2310026N09Rik, TRDL1, TALL2
MMRRC Submission 039777-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1745 (G1)
Quality Score181
Status Validated
Chromosome11
Chromosomal Location69682846-69685784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69685147 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 38 (A38V)
Ref Sequence ENSEMBL: ENSMUSP00000104288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005336] [ENSMUST00000018896] [ENSMUST00000066760] [ENSMUST00000108648] [ENSMUST00000108649] [ENSMUST00000174159] [ENSMUST00000180587] [ENSMUST00000181261] [ENSMUST00000181810]
Predicted Effect probably benign
Transcript: ENSMUST00000005336
SMART Domains Protein: ENSMUSP00000005336
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018896
AA Change: A38V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018896
Gene: ENSMUSG00000089669
AA Change: A38V

DomainStartEndE-ValueType
Blast:TNF 39 87 1e-22 BLAST
low complexity region 101 106 N/A INTRINSIC
TNF 107 240 7.41e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066760
SMART Domains Protein: ENSMUSP00000066581
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108648
AA Change: A38V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104288
Gene: ENSMUSG00000089669
AA Change: A38V

DomainStartEndE-ValueType
Blast:TNF 39 87 1e-22 BLAST
TNF 97 224 6.21e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108649
SMART Domains Protein: ENSMUSP00000104289
Gene: ENSMUSG00000018752

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
PDB:4HT1|T 110 166 1e-31 PDB
Blast:TNF 117 166 4e-27 BLAST
low complexity region 190 195 N/A INTRINSIC
TNF 196 329 7.41e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145435
Predicted Effect probably benign
Transcript: ENSMUST00000174159
SMART Domains Protein: ENSMUSP00000133951
Gene: ENSMUSG00000018752

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
TNF 117 255 6.18e-10 SMART
low complexity region 269 274 N/A INTRINSIC
TNF 275 408 7.41e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180587
SMART Domains Protein: ENSMUSP00000137973
Gene: ENSMUSG00000018752

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
TNF 118 256 6.18e-10 SMART
low complexity region 270 275 N/A INTRINSIC
TNF 276 410 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181261
SMART Domains Protein: ENSMUSP00000137916
Gene: ENSMUSG00000097328

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
Blast:TNF 72 98 8e-8 BLAST
PDB:4HT1|T 72 98 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000181810
SMART Domains Protein: ENSMUSP00000137972
Gene: ENSMUSG00000097328

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
TNF 117 248 3.67e-35 SMART
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF17/BCMA, a member of the TNF receptor family. This protein and its receptor are both found to be important for B cell development. In vitro experiments suggested that this protein may be able to induce apoptosis through its interaction with other TNF receptor family proteins such as TNFRSF6/FAS and TNFRSF14/HVEM. Alternative splicing results in multiple transcript variants. Some transcripts that skip the last exon of the upstream gene (TNFSF12) and continue into the second exon of this gene have been identified; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice are viable and fertile. No apparent defects of the immune system have been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,723 S245P probably benign Het
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Capn3 G A 2: 120,489,689 V283M possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gad1-ps A T 10: 99,445,524 noncoding transcript Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Kmt2b A T 7: 30,585,850 M539K possibly damaging Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Med15 G A 16: 17,655,706 probably benign Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
N4bp2l2 A T 5: 150,661,959 N185K probably benign Het
Nkx2-1 A G 12: 56,533,744 M137T probably benign Het
Olfr638 A G 7: 104,004,063 T269A probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rnf44 G A 13: 54,682,192 R271W probably damaging Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in Tnfsf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1517:Tnfsf13 UTSW 11 69684738 missense possibly damaging 0.91
R4825:Tnfsf13 UTSW 11 69685249 nonsense probably null
R5613:Tnfsf13 UTSW 11 69683995 splice site probably null
R6254:Tnfsf13 UTSW 11 69684483 critical splice donor site probably null
R7027:Tnfsf13 UTSW 11 69685132 critical splice acceptor site probably null
R7778:Tnfsf13 UTSW 11 69685163 missense probably damaging 0.96
R8094:Tnfsf13 UTSW 11 69685157 missense probably damaging 0.99
R8095:Tnfsf13 UTSW 11 69685157 missense probably damaging 0.99
R8096:Tnfsf13 UTSW 11 69685157 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATCTGGGCACTGACTGCCTTTC -3'
(R):5'- TGTCAGAGTGTCACTAGCTCGACC -3'

Sequencing Primer
(F):5'- ATTGAGAGGCTCTGAGACCC -3'
(R):5'- GGGACTAATAGTACCCTAGCTTG -3'
Posted On2014-05-23