Incidental Mutation 'R1745:Rundc3a'
ID193941
Institutional Source Beutler Lab
Gene Symbol Rundc3a
Ensembl Gene ENSMUSG00000006575
Gene NameRUN domain containing 3A
SynonymsRpip8, Rap2ip
MMRRC Submission 039777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1745 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location102393403-102402555 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GAGCC to GAGCCAGCC at 102400913 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006750] [ENSMUST00000018821] [ENSMUST00000107098] [ENSMUST00000107102] [ENSMUST00000107103] [ENSMUST00000107105] [ENSMUST00000124755] [ENSMUST00000130436] [ENSMUST00000134669] [ENSMUST00000142097] [ENSMUST00000149777] [ENSMUST00000154001] [ENSMUST00000155104]
Predicted Effect probably null
Transcript: ENSMUST00000006750
SMART Domains Protein: ENSMUSP00000006750
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018821
SMART Domains Protein: ENSMUSP00000018821
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 156 6.9e-23 PFAM
Pfam:Mito_carr 158 247 6.1e-19 PFAM
Pfam:Mito_carr 251 352 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107098
SMART Domains Protein: ENSMUSP00000102715
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 148 1.4e-21 PFAM
Pfam:Mito_carr 150 240 3.7e-19 PFAM
Pfam:Mito_carr 243 344 4.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107102
SMART Domains Protein: ENSMUSP00000102719
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107103
SMART Domains Protein: ENSMUSP00000102720
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 120 182 2.34e-19 SMART
coiled coil region 262 317 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107105
SMART Domains Protein: ENSMUSP00000102722
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123688
Predicted Effect probably benign
Transcript: ENSMUST00000124755
SMART Domains Protein: ENSMUSP00000120021
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 71 1.3e-9 PFAM
Pfam:Mito_carr 92 152 9.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128331
Predicted Effect probably benign
Transcript: ENSMUST00000128825
SMART Domains Protein: ENSMUSP00000121790
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 35 77 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130436
SMART Domains Protein: ENSMUSP00000115087
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 1.8e-9 PFAM
Pfam:Mito_carr 92 156 5.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132876
Predicted Effect probably benign
Transcript: ENSMUST00000134669
SMART Domains Protein: ENSMUSP00000114481
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 1.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141535
Predicted Effect probably benign
Transcript: ENSMUST00000142097
SMART Domains Protein: ENSMUSP00000114365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 63 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147860
Predicted Effect probably benign
Transcript: ENSMUST00000149777
SMART Domains Protein: ENSMUSP00000115365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 2.7e-9 PFAM
Pfam:Mito_carr 92 156 8.7e-15 PFAM
Pfam:Mito_carr 158 220 6.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153395
Predicted Effect probably benign
Transcript: ENSMUST00000154001
SMART Domains Protein: ENSMUSP00000116336
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 3.1e-10 PFAM
Pfam:Mito_carr 92 156 9.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155104
SMART Domains Protein: ENSMUSP00000115445
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 3.7e-9 PFAM
Pfam:Mito_carr 92 156 1.2e-14 PFAM
Pfam:Mito_carr 158 248 5.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183859
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,723 S245P probably benign Het
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Capn3 G A 2: 120,489,689 V283M possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gad1-ps A T 10: 99,445,524 noncoding transcript Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Kmt2b A T 7: 30,585,850 M539K possibly damaging Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Med15 G A 16: 17,655,706 probably benign Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
N4bp2l2 A T 5: 150,661,959 N185K probably benign Het
Nkx2-1 A G 12: 56,533,744 M137T probably benign Het
Olfr638 A G 7: 104,004,063 T269A probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rnf44 G A 13: 54,682,192 R271W probably damaging Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Tnfsf13 G A 11: 69,685,147 A38V probably benign Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in Rundc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Rundc3a APN 11 102393776 missense probably benign 0.43
IGL02206:Rundc3a APN 11 102399634 nonsense probably null
IGL02306:Rundc3a APN 11 102400938 missense probably damaging 1.00
IGL02838:Rundc3a APN 11 102397695 splice site probably benign
R0173:Rundc3a UTSW 11 102398245 unclassified probably benign
R1746:Rundc3a UTSW 11 102400913 frame shift probably null
R2208:Rundc3a UTSW 11 102402088 missense probably damaging 1.00
R2366:Rundc3a UTSW 11 102397665 missense probably damaging 1.00
R2994:Rundc3a UTSW 11 102400663 missense probably damaging 1.00
R3755:Rundc3a UTSW 11 102399259 missense possibly damaging 0.48
R3756:Rundc3a UTSW 11 102399259 missense possibly damaging 0.48
R5519:Rundc3a UTSW 11 102402031 missense probably benign 0.01
R5748:Rundc3a UTSW 11 102399399 missense possibly damaging 0.63
R6361:Rundc3a UTSW 11 102400795 missense probably damaging 1.00
R6722:Rundc3a UTSW 11 102399949 missense possibly damaging 0.73
R6819:Rundc3a UTSW 11 102398461 nonsense probably null
R7324:Rundc3a UTSW 11 102399973 missense possibly damaging 0.80
R7369:Rundc3a UTSW 11 102399895 missense probably damaging 1.00
R7437:Rundc3a UTSW 11 102398404 missense probably damaging 1.00
R7439:Rundc3a UTSW 11 102400046 critical splice donor site probably null
R7441:Rundc3a UTSW 11 102400046 critical splice donor site probably null
R7542:Rundc3a UTSW 11 102400045 missense probably benign 0.44
R7802:Rundc3a UTSW 11 102400009 missense probably benign 0.18
Z1176:Rundc3a UTSW 11 102400991 missense probably benign 0.02
Z1177:Rundc3a UTSW 11 102398452 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTCAAGTTTCCGTCCTAAGCCCTG -3'
(R):5'- ATGACACTAGAAAGCCGTTGCGCC -3'

Sequencing Primer
(F):5'- TAGTCAACCAGTGGCCCTC -3'
(R):5'- acaggtagaagaggtgggg -3'
Posted On2014-05-23