Incidental Mutation 'R1745:Rnf44'
ID193945
Institutional Source Beutler Lab
Gene Symbol Rnf44
Ensembl Gene ENSMUSG00000034928
Gene Namering finger protein 44
Synonyms
MMRRC Submission 039777-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1745 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54679399-54693907 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54682192 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 271 (R271W)
Ref Sequence ENSEMBL: ENSMUSP00000136732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037422] [ENSMUST00000122935] [ENSMUST00000125871] [ENSMUST00000125927] [ENSMUST00000126717] [ENSMUST00000128257] [ENSMUST00000129881] [ENSMUST00000134177] [ENSMUST00000134862] [ENSMUST00000145397] [ENSMUST00000146931] [ENSMUST00000150626] [ENSMUST00000150806] [ENSMUST00000177950]
Predicted Effect probably damaging
Transcript: ENSMUST00000037422
AA Change: R271W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043974
Gene: ENSMUSG00000034928
AA Change: R271W

DomainStartEndE-ValueType
low complexity region 104 113 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
RING 298 338 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123333
Predicted Effect probably damaging
Transcript: ENSMUST00000125871
AA Change: R353W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118474
Gene: ENSMUSG00000034928
AA Change: R353W

DomainStartEndE-ValueType
low complexity region 148 155 N/A INTRINSIC
low complexity region 186 195 N/A INTRINSIC
low complexity region 288 310 N/A INTRINSIC
RING 380 420 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125927
Predicted Effect probably benign
Transcript: ENSMUST00000126717
SMART Domains Protein: ENSMUSP00000116043
Gene: ENSMUSG00000034928

DomainStartEndE-ValueType
low complexity region 185 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128038
Predicted Effect probably damaging
Transcript: ENSMUST00000128257
AA Change: R271W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116850
Gene: ENSMUSG00000034928
AA Change: R271W

DomainStartEndE-ValueType
low complexity region 104 113 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
RING 298 338 3.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129881
Predicted Effect probably benign
Transcript: ENSMUST00000134177
Predicted Effect probably damaging
Transcript: ENSMUST00000134862
AA Change: R272W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114259
Gene: ENSMUSG00000034928
AA Change: R272W

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 207 229 N/A INTRINSIC
RING 299 339 1.5e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145215
Predicted Effect probably benign
Transcript: ENSMUST00000145397
Predicted Effect probably benign
Transcript: ENSMUST00000146931
Predicted Effect probably benign
Transcript: ENSMUST00000150626
Predicted Effect probably damaging
Transcript: ENSMUST00000150806
AA Change: R272W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123198
Gene: ENSMUSG00000034928
AA Change: R272W

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 207 229 N/A INTRINSIC
RING 299 339 1.5e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177950
AA Change: R271W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136732
Gene: ENSMUSG00000034928
AA Change: R271W

DomainStartEndE-ValueType
low complexity region 104 113 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
RING 298 338 3.21e-8 SMART
Meta Mutation Damage Score 0.7949 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,723 S245P probably benign Het
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Capn3 G A 2: 120,489,689 V283M possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gad1-ps A T 10: 99,445,524 noncoding transcript Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Kmt2b A T 7: 30,585,850 M539K possibly damaging Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Med15 G A 16: 17,655,706 probably benign Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
N4bp2l2 A T 5: 150,661,959 N185K probably benign Het
Nkx2-1 A G 12: 56,533,744 M137T probably benign Het
Olfr638 A G 7: 104,004,063 T269A probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Tnfsf13 G A 11: 69,685,147 A38V probably benign Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in Rnf44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01837:Rnf44 APN 13 54682153 missense probably damaging 1.00
IGL01934:Rnf44 APN 13 54681950 missense probably damaging 0.98
IGL02629:Rnf44 APN 13 54683062 missense possibly damaging 0.89
IGL03030:Rnf44 APN 13 54681990 nonsense probably null
R1403:Rnf44 UTSW 13 54682008 missense probably damaging 0.99
R1403:Rnf44 UTSW 13 54682008 missense probably damaging 0.99
R1654:Rnf44 UTSW 13 54681779 missense possibly damaging 0.82
R3983:Rnf44 UTSW 13 54683148 missense probably damaging 1.00
R4086:Rnf44 UTSW 13 54682335 missense possibly damaging 0.77
R4893:Rnf44 UTSW 13 54681932 critical splice donor site probably null
R5907:Rnf44 UTSW 13 54682808 missense possibly damaging 0.50
R5997:Rnf44 UTSW 13 54682800 missense possibly damaging 0.50
R6250:Rnf44 UTSW 13 54682107 splice site probably null
R6519:Rnf44 UTSW 13 54681786 missense probably damaging 1.00
R7694:Rnf44 UTSW 13 54682028 missense probably damaging 1.00
X0012:Rnf44 UTSW 13 54682847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGTGTCAGCACAGTGACAGC -3'
(R):5'- TGTAAGTGCCAGCATAACTGCCC -3'

Sequencing Primer
(F):5'- GTTAAAGCGATACGACGGCA -3'
(R):5'- CCCAGATCCTGAGTATGAACTGTG -3'
Posted On2014-05-23