Mutagenetix > Incidental Mutations

Incidental Mutation 'R1745:Erbin'

193946

Institutional Source

Beutler Lab

Gene Symbol

Erbin

Ensembl Gene

ENSMUSG00000021709

Gene Name

Erbb2 interacting protein

Synonyms

1700028E05Rik, Erbb2ip, Erbin

MMRRC Submission

039777-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103818787-103920514 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 103839449 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 646 (H646N)

Ref Sequence

ENSEMBL: ENSMUSP00000140536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022222] [ENSMUST00000053927] [ENSMUST00000091269] [ENSMUST00000169083] [ENSMUST00000188997] [ENSMUST00000191275]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022222
AA Change: H646N

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022222
Gene: ENSMUSG00000021709
AA Change: H646N

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1294	1374	3.6e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000053927
AA Change: H646N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000057956
Gene: ENSMUSG00000021709
AA Change: H646N

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1368	1448	3.6e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091269
AA Change: H646N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000088813
Gene: ENSMUSG00000021709
AA Change: H646N

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1320	1400	3.6e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169083
AA Change: H646N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000127607
Gene: ENSMUSG00000021709
AA Change: H646N

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1329	1409	3.6e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188997
AA Change: H646N

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140931
Gene: ENSMUSG00000021709
AA Change: H646N

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1212	1292	3.6e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189323

Predicted Effect

probably damaging
Transcript: ENSMUST00000191275
AA Change: H646N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140536
Gene: ENSMUSG00000021709
AA Change: H646N

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1368	1448	3.6e-16	SMART

Meta Mutation Damage Score

0.1043

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat and PDZ domain (LAP) family. The encoded protein contains 17 leucine-rich repeats and one PDZ domain. It binds to the unphosphorylated form of the ERBB2 protein and regulates ERBB2 function and localization. It has also been shown to affect the Ras signaling pathway by disrupting Ras-Raf interaction. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null or gene trapped allele exhibit impaired myelination, reduced nerve conduction, and hyporesponsiveness to tactile stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	A	G	11: 29,824,723	S245P	probably benign	Het
Abcc10	A	T	17: 46,312,433	V851E	probably benign	Het
Adam28	A	G	14: 68,633,171	I351T	probably benign	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Ap2a1	T	C	7: 44,906,945	E285G	probably damaging	Het
Arfgef1	A	C	1: 10,173,255	I1023R	probably damaging	Het
Atp2c2	G	A	8: 119,725,094	V133I	probably benign	Het
Bpifb6	A	G	2: 153,911,483	T401A	possibly damaging	Het
Capn3	G	A	2: 120,489,689	V283M	possibly damaging	Het
Chd6	A	T	2: 160,981,667	V1261E	probably damaging	Het
Col22a1	C	T	15: 72,006,787	A174T	probably damaging	Het
Crnn	T	C	3: 93,146,891	V27A	probably benign	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dgkd	T	C	1: 87,932,044		probably null	Het
Diaph3	A	G	14: 86,966,560	L554P	probably damaging	Het
Ephb4	A	T	5: 137,360,434	H293L	probably benign	Het
Faiml	T	C	9: 99,234,458	N60D	probably benign	Het
Flot1	A	G	17: 35,824,660	E102G	probably damaging	Het
Fryl	G	A	5: 73,032,861		probably benign	Het
Gad1-ps	A	T	10: 99,445,524		noncoding transcript	Het
Gtf3c3	A	G	1: 54,434,212	S81P	probably damaging	Het
Hs1bp3	C	T	12: 8,321,690	Q91*	probably null	Het
Igf1r	T	C	7: 68,169,913	C324R	probably damaging	Het
Il23r	G	A	6: 67,466,291	T276I	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Kctd1	A	T	18: 15,063,206		probably benign	Het
Kmt2b	A	T	7: 30,585,850	M539K	possibly damaging	Het
Man2b1	T	A	8: 85,093,934	F617I	probably damaging	Het
Med15	G	A	16: 17,655,706		probably benign	Het
Myo9b	A	G	8: 71,354,047	K1543R	probably damaging	Het
N4bp2	A	G	5: 65,790,822	Y265C	probably benign	Het
N4bp2l2	A	T	5: 150,661,959	N185K	probably benign	Het
Nkx2-1	A	G	12: 56,533,744	M137T	probably benign	Het
Olfr638	A	G	7: 104,004,063	T269A	probably benign	Het
Prickle2	A	T	6: 92,376,593	Y631N	probably damaging	Het
Ptpro	A	G	6: 137,400,645	T698A	probably benign	Het
Rapgef3	T	C	15: 97,750,178	I690V	probably benign	Het
Rnf44	G	A	13: 54,682,192	R271W	probably damaging	Het
Rundc3a	GAGCC	GAGCCAGCC	11: 102,400,913		probably null	Het
Ryr2	A	G	13: 11,790,267	Y904H	probably damaging	Het
Suz12	T	C	11: 80,022,096	L322P	probably damaging	Het
Tnfsf13	G	A	11: 69,685,147	A38V	probably benign	Het
Topbp1	G	A	9: 103,308,845	R62H	probably benign	Het
Tor1aip1	G	T	1: 156,030,434		probably null	Het
Trpv4	A	T	5: 114,633,154	V438E	probably damaging	Het
Tsku	A	T	7: 98,352,179	V315E	possibly damaging	Het
Ttc38	T	C	15: 85,833,172	L16P	probably damaging	Het
Vmn1r170	A	G	7: 23,606,334	I54V	probably damaging	Het
Vmn1r71	T	C	7: 10,748,269	D98G	probably benign	Het
Wdfy3	A	T	5: 101,948,929	D334E	probably damaging	Het
Zfhx3	T	A	8: 108,955,862	F3311Y	unknown	Het
Zswim9	A	G	7: 13,269,556	S123P	probably damaging	Het

Other mutations in Erbin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Erbin	APN	13	103834012	missense	probably damaging	1.00
IGL01404:Erbin	APN	13	103839464	missense	probably damaging	1.00
IGL01455:Erbin	APN	13	103859387	missense	probably damaging	1.00
IGL01871:Erbin	APN	13	103834766	missense	probably damaging	0.98
IGL01930:Erbin	APN	13	103841172	missense	probably damaging	1.00
IGL02112:Erbin	APN	13	103862336	missense	probably benign	0.12
IGL02736:Erbin	APN	13	103839395	missense	probably damaging	1.00
IGL03149:Erbin	APN	13	103841163	missense	possibly damaging	0.82
IGL03169:Erbin	APN	13	103841232	missense	possibly damaging	0.93
IGL02802:Erbin	UTSW	13	103868130	missense	probably damaging	1.00
PIT1430001:Erbin	UTSW	13	103859509	missense	probably damaging	1.00
R0329:Erbin	UTSW	13	103868865	missense	probably damaging	1.00
R0330:Erbin	UTSW	13	103868865	missense	probably damaging	1.00
R0492:Erbin	UTSW	13	103834358	missense	probably damaging	0.98
R0508:Erbin	UTSW	13	103834027	missense	probably damaging	1.00
R0589:Erbin	UTSW	13	103886287	missense	probably damaging	1.00
R1103:Erbin	UTSW	13	103886202	missense	probably benign	0.00
R1139:Erbin	UTSW	13	103884253	missense	probably damaging	1.00
R1316:Erbin	UTSW	13	103841234	missense	possibly damaging	0.94
R1675:Erbin	UTSW	13	103841178	missense	probably damaging	1.00
R1698:Erbin	UTSW	13	103833731	missense	possibly damaging	0.91
R1727:Erbin	UTSW	13	103827968	missense	probably benign	0.01
R1746:Erbin	UTSW	13	103850831	missense	probably damaging	1.00
R1764:Erbin	UTSW	13	103843451	splice site	probably benign
R1828:Erbin	UTSW	13	103860069	critical splice donor site	probably null
R1840:Erbin	UTSW	13	103834947	missense	probably benign	0.01
R1987:Erbin	UTSW	13	103886203	missense	probably benign	0.36
R1992:Erbin	UTSW	13	103833713	missense	probably benign	0.33
R2013:Erbin	UTSW	13	103857533	missense	probably damaging	1.00
R2025:Erbin	UTSW	13	103830195	missense	probably benign	0.01
R2056:Erbin	UTSW	13	103830316	missense	probably benign	0.27
R2171:Erbin	UTSW	13	103834958	missense	probably benign	0.00
R2366:Erbin	UTSW	13	103844909	missense	probably damaging	1.00
R2897:Erbin	UTSW	13	103886197	missense	probably damaging	1.00
R3912:Erbin	UTSW	13	103862287	missense	probably benign	0.35
R3912:Erbin	UTSW	13	103886338	splice site	probably benign
R4073:Erbin	UTSW	13	103860111	missense	probably damaging	1.00
R4458:Erbin	UTSW	13	103833557	missense	probably damaging	1.00
R4465:Erbin	UTSW	13	103844885	missense	probably benign	0.05
R4525:Erbin	UTSW	13	103857092	missense	probably benign
R4780:Erbin	UTSW	13	103884206	missense	probably damaging	1.00
R4877:Erbin	UTSW	13	103850838	missense	probably damaging	0.99
R4879:Erbin	UTSW	13	103834774	missense	probably benign	0.05
R5396:Erbin	UTSW	13	103857409	critical splice donor site	probably null
R5898:Erbin	UTSW	13	103839305	critical splice donor site	probably null
R5955:Erbin	UTSW	13	103830192	missense	probably benign	0.40
R6073:Erbin	UTSW	13	103844921	nonsense	probably null
R6107:Erbin	UTSW	13	103833892	missense	probably benign	0.06
R6257:Erbin	UTSW	13	103862288	missense	probably benign	0.35
R6294:Erbin	UTSW	13	103857056	missense	probably benign	0.36
R6358:Erbin	UTSW	13	103845565	missense	probably damaging	1.00
R6476:Erbin	UTSW	13	103841247	missense	probably damaging	1.00
R6485:Erbin	UTSW	13	103868113	missense	probably damaging	1.00
R6631:Erbin	UTSW	13	103824892	missense	probably benign	0.02
R6735:Erbin	UTSW	13	103884210	missense	probably damaging	1.00
R6736:Erbin	UTSW	13	103834766	missense	possibly damaging	0.72
R6749:Erbin	UTSW	13	103834377	missense	probably damaging	1.00
R7290:Erbin	UTSW	13	103862326	missense	probably damaging	1.00
R7767:Erbin	UTSW	13	103859399	missense	probably damaging	1.00
R8052:Erbin	UTSW	13	103834356	nonsense	probably null
R8104:Erbin	UTSW	13	103834977	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AAATGCACACAGACCTGACTTTGGA -3'
(R):5'- CACCTCACACATGGAGAGATTACCAC -3'

Sequencing Primer
(F):5'- GAGTTACTATCCACGGGAGTC -3'
(R):5'- tgtttacatttgaaataaaGGAACCG -3'

Posted On

2014-05-23