Mutagenetix > Incidental Mutations

Incidental Mutation 'R1745:Col22a1'

193949

Institutional Source

Beutler Lab

Gene Symbol

Col22a1

Ensembl Gene

ENSMUSG00000079022

Gene Name

collagen, type XXII, alpha 1

Synonyms

C80743, 2310067L16Rik

MMRRC Submission

039777-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1745 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

71795795-72034227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 72006787 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 174 (A174T)

Ref Sequence

ENSEMBL: ENSMUSP00000125069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159993]

AlphaFold

E9Q7P1

Predicted Effect

probably damaging
Transcript: ENSMUST00000159993
AA Change: A174T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: A174T

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
VWA	45	227	1.35e-51	SMART
TSPN	248	436	1.26e-33	SMART
low complexity region	454	470	N/A	INTRINSIC
internal_repeat_3	494	555	1.96e-13	PROSPERO
internal_repeat_1	496	643	1.49e-19	PROSPERO
low complexity region	644	657	N/A	INTRINSIC
low complexity region	673	707	N/A	INTRINSIC
Pfam:Collagen	751	823	1.5e-9	PFAM
Pfam:Collagen	810	863	2.3e-10	PFAM
Pfam:Collagen	869	931	4.8e-11	PFAM
Pfam:Collagen	926	990	1.1e-10	PFAM
Pfam:Collagen	1031	1087	1.7e-10	PFAM
Pfam:Collagen	1104	1162	1.8e-11	PFAM
low complexity region	1173	1227	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
internal_repeat_2	1257	1348	3.25e-18	PROSPERO
internal_repeat_4	1268	1347	9.67e-7	PROSPERO
Pfam:Collagen	1389	1448	4e-10	PFAM
Pfam:Collagen	1481	1540	2.6e-9	PFAM
low complexity region	1546	1558	N/A	INTRINSIC
low complexity region	1580	1590	N/A	INTRINSIC

Meta Mutation Damage Score

0.2383

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	A	G	11: 29,824,723	S245P	probably benign	Het
Abcc10	A	T	17: 46,312,433	V851E	probably benign	Het
Adam28	A	G	14: 68,633,171	I351T	probably benign	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Ap2a1	T	C	7: 44,906,945	E285G	probably damaging	Het
Arfgef1	A	C	1: 10,173,255	I1023R	probably damaging	Het
Atp2c2	G	A	8: 119,725,094	V133I	probably benign	Het
Bpifb6	A	G	2: 153,911,483	T401A	possibly damaging	Het
Capn3	G	A	2: 120,489,689	V283M	possibly damaging	Het
Chd6	A	T	2: 160,981,667	V1261E	probably damaging	Het
Crnn	T	C	3: 93,146,891	V27A	probably benign	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dgkd	T	C	1: 87,932,044		probably null	Het
Diaph3	A	G	14: 86,966,560	L554P	probably damaging	Het
Ephb4	A	T	5: 137,360,434	H293L	probably benign	Het
Erbin	G	T	13: 103,839,449	H646N	probably damaging	Het
Faiml	T	C	9: 99,234,458	N60D	probably benign	Het
Flot1	A	G	17: 35,824,660	E102G	probably damaging	Het
Fryl	G	A	5: 73,032,861		probably benign	Het
Gad1-ps	A	T	10: 99,445,524		noncoding transcript	Het
Gtf3c3	A	G	1: 54,434,212	S81P	probably damaging	Het
Hs1bp3	C	T	12: 8,321,690	Q91*	probably null	Het
Igf1r	T	C	7: 68,169,913	C324R	probably damaging	Het
Il23r	G	A	6: 67,466,291	T276I	probably damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Kctd1	A	T	18: 15,063,206		probably benign	Het
Kmt2b	A	T	7: 30,585,850	M539K	possibly damaging	Het
Man2b1	T	A	8: 85,093,934	F617I	probably damaging	Het
Med15	G	A	16: 17,655,706		probably benign	Het
Myo9b	A	G	8: 71,354,047	K1543R	probably damaging	Het
N4bp2	A	G	5: 65,790,822	Y265C	probably benign	Het
N4bp2l2	A	T	5: 150,661,959	N185K	probably benign	Het
Nkx2-1	A	G	12: 56,533,744	M137T	probably benign	Het
Olfr638	A	G	7: 104,004,063	T269A	probably benign	Het
Prickle2	A	T	6: 92,376,593	Y631N	probably damaging	Het
Ptpro	A	G	6: 137,400,645	T698A	probably benign	Het
Rapgef3	T	C	15: 97,750,178	I690V	probably benign	Het
Rnf44	G	A	13: 54,682,192	R271W	probably damaging	Het
Rundc3a	GAGCC	GAGCCAGCC	11: 102,400,913		probably null	Het
Ryr2	A	G	13: 11,790,267	Y904H	probably damaging	Het
Suz12	T	C	11: 80,022,096	L322P	probably damaging	Het
Tnfsf13	G	A	11: 69,685,147	A38V	probably benign	Het
Topbp1	G	A	9: 103,308,845	R62H	probably benign	Het
Tor1aip1	G	T	1: 156,030,434		probably null	Het
Trpv4	A	T	5: 114,633,154	V438E	probably damaging	Het
Tsku	A	T	7: 98,352,179	V315E	possibly damaging	Het
Ttc38	T	C	15: 85,833,172	L16P	probably damaging	Het
Vmn1r170	A	G	7: 23,606,334	I54V	probably damaging	Het
Vmn1r71	T	C	7: 10,748,269	D98G	probably benign	Het
Wdfy3	A	T	5: 101,948,929	D334E	probably damaging	Het
Zfhx3	T	A	8: 108,955,862	F3311Y	unknown	Het
Zswim9	A	G	7: 13,269,556	S123P	probably damaging	Het

Other mutations in Col22a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Col22a1	APN	15	71860958	critical splice donor site	probably null
IGL00434:Col22a1	APN	15	72006675	missense	possibly damaging	0.71
IGL00721:Col22a1	APN	15	71846177	missense	unknown
IGL00902:Col22a1	APN	15	71964659	missense	probably damaging	1.00
IGL01311:Col22a1	APN	15	71973637	splice site	probably benign
IGL01329:Col22a1	APN	15	71907040	missense	probably benign	0.02
IGL01527:Col22a1	APN	15	71907031	missense	probably damaging	0.98
IGL01870:Col22a1	APN	15	71952528	missense	probably benign	0.07
IGL02002:Col22a1	APN	15	71811097	splice site	probably benign
IGL02248:Col22a1	APN	15	71799448	missense	unknown
IGL02322:Col22a1	APN	15	71822653	missense	unknown
IGL02472:Col22a1	APN	15	71827753	splice site	probably benign
IGL02685:Col22a1	APN	15	71801915	missense	unknown
IGL02888:Col22a1	APN	15	71846219	missense	unknown
IGL02971:Col22a1	APN	15	72006738	missense	probably damaging	1.00
IGL03175:Col22a1	APN	15	71969103	missense	possibly damaging	0.81
IGL03240:Col22a1	APN	15	71807928	missense	unknown
R0083:Col22a1	UTSW	15	71890497	missense	possibly damaging	0.70
R0383:Col22a1	UTSW	15	71869004	missense	unknown
R0449:Col22a1	UTSW	15	71962671	critical splice donor site	probably null
R0508:Col22a1	UTSW	15	71933413	missense	unknown
R0944:Col22a1	UTSW	15	71881662	missense	probably benign	0.03
R1289:Col22a1	UTSW	15	71837377	missense	unknown
R1436:Col22a1	UTSW	15	71922957	splice site	probably benign
R1439:Col22a1	UTSW	15	71952377	splice site	probably benign
R1460:Col22a1	UTSW	15	71821931	missense	unknown
R1680:Col22a1	UTSW	15	71799361	missense	unknown
R1715:Col22a1	UTSW	15	72006981	missense	possibly damaging	0.79
R1742:Col22a1	UTSW	15	71801913	missense	unknown
R1763:Col22a1	UTSW	15	72007176	missense	probably damaging	0.96
R1932:Col22a1	UTSW	15	71870140	missense	unknown
R2125:Col22a1	UTSW	15	71848577	missense	unknown
R2126:Col22a1	UTSW	15	71857253	nonsense	probably null
R2137:Col22a1	UTSW	15	72006948	missense	possibly damaging	0.46
R2860:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2861:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2862:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R3704:Col22a1	UTSW	15	71970307	missense	probably damaging	1.00
R3778:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R3940:Col22a1	UTSW	15	71981933	nonsense	probably null
R3950:Col22a1	UTSW	15	71977358	missense	possibly damaging	0.90
R4240:Col22a1	UTSW	15	72007131	missense	probably damaging	1.00
R4531:Col22a1	UTSW	15	72007149	missense	probably damaging	1.00
R4597:Col22a1	UTSW	15	71964662	missense	possibly damaging	0.83
R4604:Col22a1	UTSW	15	71952339	missense	probably benign	0.36
R4654:Col22a1	UTSW	15	71973695	missense	possibly damaging	0.95
R4782:Col22a1	UTSW	15	71801925	missense	unknown
R4847:Col22a1	UTSW	15	71799499	missense	unknown
R4980:Col22a1	UTSW	15	71801943	missense	unknown
R4981:Col22a1	UTSW	15	71861066	missense	unknown
R4996:Col22a1	UTSW	15	72007161	missense	probably damaging	0.99
R5007:Col22a1	UTSW	15	71944422	missense	probably damaging	1.00
R5135:Col22a1	UTSW	15	71799337	missense	unknown
R5197:Col22a1	UTSW	15	72009406	missense	probably damaging	0.96
R5292:Col22a1	UTSW	15	71970336	missense	probably damaging	1.00
R5449:Col22a1	UTSW	15	71821949	missense	unknown
R5480:Col22a1	UTSW	15	71964611	missense	probably damaging	0.98
R5627:Col22a1	UTSW	15	71981918	missense	probably damaging	0.98
R5828:Col22a1	UTSW	15	72009491	missense	probably benign	0.01
R5927:Col22a1	UTSW	15	72006966	missense	probably damaging	1.00
R6006:Col22a1	UTSW	15	71973836	missense	probably damaging	1.00
R6245:Col22a1	UTSW	15	71973816	missense	probably damaging	0.99
R6288:Col22a1	UTSW	15	71894869	critical splice acceptor site	probably null
R6482:Col22a1	UTSW	15	71890489	missense	possibly damaging	0.93
R6497:Col22a1	UTSW	15	71890576	missense	possibly damaging	0.85
R6579:Col22a1	UTSW	15	71881653	missense	probably benign	0.18
R6643:Col22a1	UTSW	15	71822037	splice site	probably null
R6663:Col22a1	UTSW	15	71820059	missense	unknown
R7179:Col22a1	UTSW	15	71933413	missense	unknown
R7215:Col22a1	UTSW	15	71970332	nonsense	probably null
R7216:Col22a1	UTSW	15	71973845	missense	probably damaging	1.00
R7505:Col22a1	UTSW	15	71799399	nonsense	probably null
R7585:Col22a1	UTSW	15	71892205	missense	probably damaging	0.99
R7699:Col22a1	UTSW	15	71973851	missense	probably damaging	1.00
R7788:Col22a1	UTSW	15	71952317	critical splice donor site	probably null
R7921:Col22a1	UTSW	15	71981962	splice site	probably null
R8205:Col22a1	UTSW	15	71861069	missense	unknown
R8769:Col22a1	UTSW	15	72006722	missense	probably benign	0.21
R8780:Col22a1	UTSW	15	72006947	missense	probably damaging	0.99
R8827:Col22a1	UTSW	15	71902816	critical splice donor site	probably null
R8843:Col22a1	UTSW	15	72006654	missense	probably damaging	1.00
R8982:Col22a1	UTSW	15	71973638	critical splice donor site	probably null
R9031:Col22a1	UTSW	15	71881674	nonsense	probably null
R9036:Col22a1	UTSW	15	71890582	missense	probably damaging	1.00
R9084:Col22a1	UTSW	15	71820080	missense	unknown
R9281:Col22a1	UTSW	15	71861071	missense	unknown
R9386:Col22a1	UTSW	15	71981945	missense	probably damaging	1.00
R9406:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
X0066:Col22a1	UTSW	15	71801879	missense	unknown
X0066:Col22a1	UTSW	15	71846200	missense	unknown
Y5406:Col22a1	UTSW	15	71799515	missense	unknown
Z1177:Col22a1	UTSW	15	71915120	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCCTTGGGAGAAGACAGAACTCCAC -3'
(R):5'- GCCTTTGAACTGGGCCACTTCAAC -3'

Sequencing Primer
(F):5'- GAGCTGGGCAACTCACTTTC -3'
(R):5'- GGGCCACTTCAACTCTCG -3'

Posted On

2014-05-23