Incidental Mutation 'R1745:Med15'
ID193952
Institutional Source Beutler Lab
Gene Symbol Med15
Ensembl Gene ENSMUSG00000012114
Gene Namemediator complex subunit 15
SynonymsPcqap, A230074L19Rik
MMRRC Submission 039777-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R1745 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17651208-17732891 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 17655706 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000012259] [ENSMUST00000056962] [ENSMUST00000080936] [ENSMUST00000182117] [ENSMUST00000231674] [ENSMUST00000232236] [ENSMUST00000232645]
Predicted Effect unknown
Transcript: ENSMUST00000012259
AA Change: P462S
SMART Domains Protein: ENSMUSP00000012259
Gene: ENSMUSG00000012114
AA Change: P462S

DomainStartEndE-ValueType
Pfam:Med15 17 789 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056962
SMART Domains Protein: ENSMUSP00000049541
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 50 105 4.1e-24 PFAM
low complexity region 154 164 N/A INTRINSIC
Pfam:CCDC74_C 209 326 1.4e-49 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000080936
AA Change: P422S
SMART Domains Protein: ENSMUSP00000079737
Gene: ENSMUSG00000012114
AA Change: P422S

DomainStartEndE-ValueType
Pfam:Med15 17 749 1.2e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182117
SMART Domains Protein: ENSMUSP00000138657
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Pfam:CCDC92 36 97 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182671
Predicted Effect probably benign
Transcript: ENSMUST00000183279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231480
Predicted Effect silent
Transcript: ENSMUST00000231674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232012
Predicted Effect unknown
Transcript: ENSMUST00000232236
AA Change: P462S
Predicted Effect unknown
Transcript: ENSMUST00000232645
AA Change: P312S
Meta Mutation Damage Score 0.0873 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,723 S245P probably benign Het
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Capn3 G A 2: 120,489,689 V283M possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gad1-ps A T 10: 99,445,524 noncoding transcript Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Kmt2b A T 7: 30,585,850 M539K possibly damaging Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
N4bp2l2 A T 5: 150,661,959 N185K probably benign Het
Nkx2-1 A G 12: 56,533,744 M137T probably benign Het
Olfr638 A G 7: 104,004,063 T269A probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rnf44 G A 13: 54,682,192 R271W probably damaging Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Tnfsf13 G A 11: 69,685,147 A38V probably benign Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in Med15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Med15 APN 16 17680726 missense probably damaging 0.96
IGL00780:Med15 APN 16 17653487 missense probably damaging 1.00
IGL02365:Med15 APN 16 17671606 intron probably benign
R0324:Med15 UTSW 16 17697612 missense probably damaging 0.98
R1225:Med15 UTSW 16 17722788 missense probably damaging 1.00
R1695:Med15 UTSW 16 17722780 missense probably damaging 0.96
R1801:Med15 UTSW 16 17680735 missense possibly damaging 0.66
R1838:Med15 UTSW 16 17653562 missense probably benign 0.11
R1901:Med15 UTSW 16 17673154 unclassified probably benign
R2153:Med15 UTSW 16 17685451 critical splice donor site probably null
R2974:Med15 UTSW 16 17652711 missense probably damaging 1.00
R3808:Med15 UTSW 16 17655734 unclassified probably benign
R3809:Med15 UTSW 16 17655734 unclassified probably benign
R4240:Med15 UTSW 16 17655494 missense probably damaging 1.00
R4483:Med15 UTSW 16 17671564 intron probably benign
R4484:Med15 UTSW 16 17671564 intron probably benign
R4577:Med15 UTSW 16 17674515 nonsense probably null
R5652:Med15 UTSW 16 17655191 missense probably damaging 1.00
R6244:Med15 UTSW 16 17652745 nonsense probably null
R6701:Med15 UTSW 16 17671583 intron probably benign
R6793:Med15 UTSW 16 17652703 unclassified probably benign
R7036:Med15 UTSW 16 17698155 start codon destroyed probably null
R7038:Med15 UTSW 16 17652727 missense possibly damaging 0.90
R7211:Med15 UTSW 16 17698113 missense unknown
R7317:Med15 UTSW 16 17671643 missense unknown
R7390:Med15 UTSW 16 17722762 missense unknown
R7471:Med15 UTSW 16 17722865 missense probably benign 0.03
R7726:Med15 UTSW 16 17655174 missense possibly damaging 0.87
Z1177:Med15 UTSW 16 17653232 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACCAGGGGTGTTTAAAGGTCCAGG -3'
(R):5'- ACCATGTGTTATGTGTGCCCAGAG -3'

Sequencing Primer
(F):5'- CTGTCACTGGGCTCTGAGAAG -3'
(R):5'- CCCAGAGGTAAGGCTTGTG -3'
Posted On2014-05-23