Incidental Mutation 'R0035:Nr1h5'
ID19397
Institutional Source Beutler Lab
Gene Symbol Nr1h5
Ensembl Gene ENSMUSG00000048938
Gene Namenuclear receptor subfamily 1, group H, member 5
SynonymsFXRB
MMRRC Submission 038329-MU
Accession Numbers

Ncbi RefSeq: NM_198658.2, NM_201619.2, NM_201622.2

Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R0035 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location102939658-102964133 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 102949573 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 208 (K208*)
Ref Sequence ENSEMBL: ENSMUSP00000142345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058899] [ENSMUST00000196135] [ENSMUST00000196983] [ENSMUST00000197412] [ENSMUST00000198472]
Predicted Effect probably null
Transcript: ENSMUST00000058899
AA Change: K208*
SMART Domains Protein: ENSMUSP00000052557
Gene: ENSMUSG00000048938
AA Change: K208*

DomainStartEndE-ValueType
Blast:HOLI 2 47 5e-9 BLAST
ZnF_C4 119 190 2.51e-36 SMART
HOLI 289 474 1.74e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083774
Predicted Effect probably null
Transcript: ENSMUST00000196135
AA Change: K150*
SMART Domains Protein: ENSMUSP00000143445
Gene: ENSMUSG00000048938
AA Change: K150*

DomainStartEndE-ValueType
ZnF_C4 78 132 1.17e-7 SMART
HOLI 231 416 1.74e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196983
AA Change: K208*
SMART Domains Protein: ENSMUSP00000142799
Gene: ENSMUSG00000048938
AA Change: K208*

DomainStartEndE-ValueType
Blast:HOLI 2 47 5e-9 BLAST
ZnF_C4 119 190 2.51e-36 SMART
HOLI 289 466 1.76e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197412
AA Change: K208*
SMART Domains Protein: ENSMUSP00000143764
Gene: ENSMUSG00000048938
AA Change: K208*

DomainStartEndE-ValueType
Blast:HOLI 2 47 4e-9 BLAST
ZnF_C4 119 190 1e-38 SMART
Pfam:Hormone_recep 274 362 6e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198472
AA Change: K208*
SMART Domains Protein: ENSMUSP00000142345
Gene: ENSMUSG00000048938
AA Change: K208*

DomainStartEndE-ValueType
Blast:HOLI 2 47 4e-9 BLAST
ZnF_C4 119 190 1e-38 SMART
Pfam:Hormone_recep 273 367 5.8e-6 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,788,549 T20A probably benign Het
4932438A13Rik T A 3: 36,987,598 Y2708* probably null Het
9130011E15Rik A T 19: 45,891,240 M558K probably damaging Het
Aadacl4 A G 4: 144,617,941 T96A probably damaging Het
Abcb6 A G 1: 75,175,007 V473A possibly damaging Het
Abo C A 2: 26,843,373 K273N possibly damaging Het
Acvr1c A G 2: 58,315,779 probably benign Het
Adcy8 A T 15: 64,699,368 V1142D probably benign Het
Akna T A 4: 63,382,445 H591L probably benign Het
Aox2 T C 1: 58,354,422 V1247A probably benign Het
Ap4b1 T C 3: 103,820,664 probably benign Het
Atm A G 9: 53,513,180 V607A probably benign Het
Cass4 C T 2: 172,416,492 P137S probably damaging Het
Cfap53 A G 18: 74,300,207 E121G probably damaging Het
Chmp6 T C 11: 119,916,682 V31A probably damaging Het
Clec4a3 T A 6: 122,967,549 Y185N probably damaging Het
Clic5 A G 17: 44,275,313 T230A probably damaging Het
Clspn G T 4: 126,565,003 probably null Het
Cntn1 T A 15: 92,232,088 probably benign Het
Col4a3 G A 1: 82,672,753 G577R unknown Het
Defa21 T A 8: 21,025,768 probably null Het
Deup1 T C 9: 15,599,821 R221G possibly damaging Het
Dnah8 A T 17: 30,683,621 probably benign Het
Dnase1l2 A G 17: 24,441,075 V273A probably damaging Het
Gm5134 T A 10: 75,993,864 F328Y probably benign Het
Golph3 A T 15: 12,339,690 E96D probably damaging Het
Hspd1 A G 1: 55,083,783 V151A probably benign Het
Htr1f A C 16: 64,926,497 I144S probably damaging Het
Il1f8 A T 2: 24,159,878 H167L probably benign Het
Il23r A G 6: 67,473,788 probably benign Het
Il25 A G 14: 54,933,096 E42G probably damaging Het
Klrb1-ps1 C T 6: 129,129,343 A149V possibly damaging Het
Kmt2e T A 5: 23,485,621 probably benign Het
Ktn1 A G 14: 47,730,379 N1167D probably benign Het
Lama4 T A 10: 39,072,738 D832E probably benign Het
Map1b A G 13: 99,435,338 S292P probably damaging Het
Map6 C T 7: 99,317,608 T345I probably damaging Het
Mark2 A T 19: 7,284,652 probably benign Het
Me3 C A 7: 89,851,759 H559Q probably benign Het
Myo1b A G 1: 51,778,382 F574L probably damaging Het
Nos2 T C 11: 78,945,727 S431P probably damaging Het
Nup214 T C 2: 31,990,367 probably null Het
Obp2b T C 2: 25,738,633 L133P probably damaging Het
Olfr173 A T 16: 58,797,122 C241* probably null Het
Olfr305 T C 7: 86,364,187 D50G possibly damaging Het
Osbp2 C T 11: 3,717,997 probably benign Het
Ptafr C A 4: 132,579,553 L85I probably benign Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Rad50 A G 11: 53,655,027 probably benign Het
Rasef G T 4: 73,762,854 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Tbc1d1 T A 5: 64,256,737 I18N probably damaging Het
Tbc1d17 T C 7: 44,841,408 N587D probably benign Het
Trank1 A T 9: 111,366,776 K1289N probably benign Het
Tspyl3 A G 2: 153,224,320 S333P probably damaging Het
Ush2a G A 1: 188,356,888 V347I probably benign Het
Usp17le G T 7: 104,769,062 S291* probably null Het
Usp24 T A 4: 106,368,027 S619T probably benign Het
Vmn2r10 T C 5: 108,997,601 probably benign Het
Vmn2r78 A G 7: 86,920,205 E102G probably benign Het
Vwa3b G A 1: 37,165,689 V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 I639R probably damaging Het
Xpo5 A G 17: 46,240,175 T1001A probably benign Het
Zc3h12c A T 9: 52,143,747 M235K probably benign Het
Zfp619 G A 7: 39,537,282 G912D probably damaging Het
Other mutations in Nr1h5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01829:Nr1h5 APN 3 102949079 missense probably benign 0.02
IGL02021:Nr1h5 APN 3 102947742 intron probably benign
IGL02025:Nr1h5 APN 3 102949626 splice site probably benign
IGL02094:Nr1h5 APN 3 102952196 nonsense probably null
R0035:Nr1h5 UTSW 3 102949573 nonsense probably null
R1200:Nr1h5 UTSW 3 102947862 missense probably damaging 1.00
R1977:Nr1h5 UTSW 3 102947817 missense probably damaging 1.00
R4173:Nr1h5 UTSW 3 102952230 missense probably damaging 1.00
R4556:Nr1h5 UTSW 3 102946141 missense probably benign 0.28
R5018:Nr1h5 UTSW 3 102947795 missense probably damaging 1.00
R5471:Nr1h5 UTSW 3 102949126 missense possibly damaging 0.74
R5617:Nr1h5 UTSW 3 102947829 missense probably damaging 1.00
R5822:Nr1h5 UTSW 3 102949328 missense probably damaging 1.00
R6243:Nr1h5 UTSW 3 102949064 missense probably benign 0.00
R6442:Nr1h5 UTSW 3 102941111 missense probably damaging 1.00
R6754:Nr1h5 UTSW 3 102949597 missense probably damaging 1.00
R6789:Nr1h5 UTSW 3 102958361 missense possibly damaging 0.81
R7235:Nr1h5 UTSW 3 102949042 critical splice donor site probably null
R7294:Nr1h5 UTSW 3 102945262 missense probably benign 0.00
R7756:Nr1h5 UTSW 3 102949609 missense probably benign 0.00
R7882:Nr1h5 UTSW 3 102949615 missense possibly damaging 0.80
R7965:Nr1h5 UTSW 3 102949615 missense possibly damaging 0.80
X0061:Nr1h5 UTSW 3 102945248 splice site probably null
X0067:Nr1h5 UTSW 3 102949126 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGTCCCTTGGTAAACTTCATTAGCCCTT -3'
(R):5'- AGGAAATTTAATAGATGCAGACATGCACGA -3'

Sequencing Primer
(F):5'- GTATTCAGAAGCCGATGTTCC -3'
(R):5'- ACAGTGTTGTTTTCCGAGCC -3'
Posted On2013-04-11