Incidental Mutation 'R1746:Trmt44'
ID 193974
Institutional Source Beutler Lab
Gene Symbol Trmt44
Ensembl Gene ENSMUSG00000029097
Gene Name tRNA methyltransferase 44
Synonyms 2310079F23Rik
MMRRC Submission 039778-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R1746 (G1)
Quality Score 206
Status Validated
Chromosome 5
Chromosomal Location 35713547-35732414 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35721403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 587 (S587P)
Ref Sequence ENSEMBL: ENSMUSP00000030980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030980]
AlphaFold Q9D2Q2
Predicted Effect probably benign
Transcript: ENSMUST00000030980
AA Change: S587P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030980
Gene: ENSMUSG00000029097
AA Change: S587P

DomainStartEndE-ValueType
Pfam:AdoMet_MTase 252 363 3.1e-42 PFAM
low complexity region 524 540 N/A INTRINSIC
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative tRNA methyltransferase found in the cytoplasm. Defects in this gene may be a cause of partial epilepsy with pericentral spikes (PEPS), but that has not been proven definitively. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,927,717 (GRCm39) probably null Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Aknad1 A G 3: 108,659,099 (GRCm39) T38A possibly damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arhgap21 T C 2: 20,865,910 (GRCm39) E902G probably damaging Het
Atg2b A G 12: 105,635,588 (GRCm39) S227P possibly damaging Het
Atp2c2 C T 8: 120,461,182 (GRCm39) probably benign Het
Atxn10 T C 15: 85,260,864 (GRCm39) V203A probably damaging Het
Chd9 A C 8: 91,737,326 (GRCm39) E1468D probably benign Het
Cntn5 T A 9: 9,831,577 (GRCm39) D601V probably damaging Het
Col4a2 G A 8: 11,496,020 (GRCm39) G1547D probably benign Het
Cul1 A G 6: 47,485,179 (GRCm39) E270G probably damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dmgdh C A 13: 93,888,933 (GRCm39) T857K probably benign Het
Ednra T G 8: 78,398,211 (GRCm39) T279P probably benign Het
Erbin A G 13: 103,987,339 (GRCm39) I407T probably damaging Het
Fggy A G 4: 95,814,965 (GRCm39) Y440C probably damaging Het
Flrt2 A T 12: 95,747,566 (GRCm39) N635Y possibly damaging Het
Fnbp1l A G 3: 122,350,140 (GRCm39) I357T probably benign Het
Gulp1 A G 1: 44,793,513 (GRCm39) H58R possibly damaging Het
Hid1 A T 11: 115,245,464 (GRCm39) V446E probably damaging Het
Igfn1 A G 1: 135,897,561 (GRCm39) S1002P possibly damaging Het
Klri1 A G 6: 129,675,118 (GRCm39) probably null Het
Kmt2d A C 15: 98,762,259 (GRCm39) L409R probably damaging Het
Ltn1 A C 16: 87,208,669 (GRCm39) S810A possibly damaging Het
Mysm1 G A 4: 94,836,648 (GRCm39) Q721* probably null Het
Nae1 A G 8: 105,254,017 (GRCm39) V105A possibly damaging Het
Nagpa C T 16: 5,021,503 (GRCm39) V83M probably damaging Het
Nrg2 G A 18: 36,154,975 (GRCm39) T503M probably damaging Het
Nrxn3 A G 12: 89,221,789 (GRCm39) M150V possibly damaging Het
Or5p52 C A 7: 107,502,093 (GRCm39) H56Q probably benign Het
Or8g28 A G 9: 39,169,498 (GRCm39) S157P probably damaging Het
Papola T A 12: 105,773,468 (GRCm39) D162E probably benign Het
Plxnc1 T C 10: 94,680,041 (GRCm39) probably null Het
Ppp1r16b T A 2: 158,588,585 (GRCm39) probably null Het
Ptprq T A 10: 107,474,691 (GRCm39) E1338V probably damaging Het
Puf60 G A 15: 75,942,633 (GRCm39) H437Y probably benign Het
Qsox2 C T 2: 26,110,650 (GRCm39) V189I probably benign Het
Rad51ap2 A T 12: 11,507,776 (GRCm39) D566V probably benign Het
Rb1cc1 T A 1: 6,333,237 (GRCm39) probably null Het
Rfpl4b C T 10: 38,697,049 (GRCm39) C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,291,739 (GRCm39) probably null Het
Scara5 A C 14: 65,968,539 (GRCm39) M271L probably benign Het
Sel1l2 A G 2: 140,127,157 (GRCm39) L118P probably damaging Het
Sema6a T A 18: 47,439,416 (GRCm39) probably benign Het
Siglech T A 7: 55,418,252 (GRCm39) H73Q probably benign Het
Sim1 A G 10: 50,860,205 (GRCm39) D689G probably benign Het
Skp2 T C 15: 9,139,530 (GRCm39) E55G possibly damaging Het
Slc1a1 T A 19: 28,871,869 (GRCm39) V114E probably benign Het
Slc26a6 G A 9: 108,738,916 (GRCm39) G614D probably benign Het
Sptbn2 C T 19: 4,795,992 (GRCm39) Q1724* probably null Het
Tet3 T C 6: 83,345,050 (GRCm39) T1796A probably damaging Het
Tmem117 A C 15: 94,829,714 (GRCm39) D183A possibly damaging Het
Ttn G T 2: 76,619,166 (GRCm39) probably benign Het
Tubgcp5 G A 7: 55,458,285 (GRCm39) V399M probably benign Het
Txndc2 T A 17: 65,945,130 (GRCm39) D349V probably damaging Het
Uggt2 T A 14: 119,250,915 (GRCm39) N1194I probably benign Het
Vmn1r178 A T 7: 23,593,329 (GRCm39) I53L probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Other mutations in Trmt44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Trmt44 APN 5 35,726,147 (GRCm39) missense possibly damaging 0.61
IGL02139:Trmt44 APN 5 35,726,143 (GRCm39) nonsense probably null
IGL02223:Trmt44 APN 5 35,731,989 (GRCm39) missense probably benign 0.00
IGL02273:Trmt44 APN 5 35,731,457 (GRCm39) missense probably damaging 1.00
IGL02667:Trmt44 APN 5 35,728,396 (GRCm39) missense probably damaging 1.00
IGL03144:Trmt44 APN 5 35,721,766 (GRCm39) missense probably benign 0.27
R0207:Trmt44 UTSW 5 35,730,261 (GRCm39) missense possibly damaging 0.95
R0540:Trmt44 UTSW 5 35,726,103 (GRCm39) critical splice donor site probably null
R0607:Trmt44 UTSW 5 35,726,103 (GRCm39) critical splice donor site probably null
R1681:Trmt44 UTSW 5 35,727,321 (GRCm39) missense probably benign 0.13
R2128:Trmt44 UTSW 5 35,732,176 (GRCm39) missense probably benign 0.05
R4190:Trmt44 UTSW 5 35,732,314 (GRCm39) missense possibly damaging 0.60
R4611:Trmt44 UTSW 5 35,732,351 (GRCm39) missense probably benign 0.13
R4684:Trmt44 UTSW 5 35,715,387 (GRCm39) missense probably benign 0.07
R5114:Trmt44 UTSW 5 35,722,812 (GRCm39) missense possibly damaging 0.67
R5951:Trmt44 UTSW 5 35,730,032 (GRCm39) unclassified probably benign
R6125:Trmt44 UTSW 5 35,722,842 (GRCm39) missense probably damaging 1.00
R7131:Trmt44 UTSW 5 35,728,410 (GRCm39) missense probably damaging 1.00
R7239:Trmt44 UTSW 5 35,732,130 (GRCm39) missense probably benign 0.00
R7265:Trmt44 UTSW 5 35,721,647 (GRCm39) missense probably benign 0.13
R7561:Trmt44 UTSW 5 35,715,336 (GRCm39) missense possibly damaging 0.47
R8543:Trmt44 UTSW 5 35,732,374 (GRCm39) missense probably benign 0.01
R8552:Trmt44 UTSW 5 35,722,744 (GRCm39) missense probably benign 0.04
R8560:Trmt44 UTSW 5 35,715,295 (GRCm39) missense probably benign 0.00
R8850:Trmt44 UTSW 5 35,721,673 (GRCm39) missense probably benign 0.02
R9209:Trmt44 UTSW 5 35,731,422 (GRCm39) critical splice donor site probably null
R9330:Trmt44 UTSW 5 35,727,264 (GRCm39) missense probably damaging 1.00
R9588:Trmt44 UTSW 5 35,727,256 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAATGAGCAGGTTTCAGCCAATG -3'
(R):5'- AGGACAGTTGCAGGACCGTCAATG -3'

Sequencing Primer
(F):5'- GGTTTCAGCCAATGAACAATCAG -3'
(R):5'- ACCGTCAATGCTGGGTC -3'
Posted On 2014-05-23