Incidental Mutation 'R1746:Cntn5'
ID 193990
Institutional Source Beutler Lab
Gene Symbol Cntn5
Ensembl Gene ENSMUSG00000039488
Gene Name contactin 5
Synonyms A830025P08Rik, 6720426O10Rik, NB-2, LOC244683
MMRRC Submission 039778-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1746 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 9660896-10904780 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9831577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 601 (D601V)
Ref Sequence ENSEMBL: ENSMUSP00000124327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]
AlphaFold P68500
Predicted Effect probably damaging
Transcript: ENSMUST00000074133
AA Change: D601V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: D601V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160216
AA Change: D601V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: D601V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162484
AA Change: D396V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: D396V

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179049
AA Change: D396V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: D396V

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Meta Mutation Damage Score 0.5730 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,927,717 (GRCm39) probably null Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Aknad1 A G 3: 108,659,099 (GRCm39) T38A possibly damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arhgap21 T C 2: 20,865,910 (GRCm39) E902G probably damaging Het
Atg2b A G 12: 105,635,588 (GRCm39) S227P possibly damaging Het
Atp2c2 C T 8: 120,461,182 (GRCm39) probably benign Het
Atxn10 T C 15: 85,260,864 (GRCm39) V203A probably damaging Het
Chd9 A C 8: 91,737,326 (GRCm39) E1468D probably benign Het
Col4a2 G A 8: 11,496,020 (GRCm39) G1547D probably benign Het
Cul1 A G 6: 47,485,179 (GRCm39) E270G probably damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dmgdh C A 13: 93,888,933 (GRCm39) T857K probably benign Het
Ednra T G 8: 78,398,211 (GRCm39) T279P probably benign Het
Erbin A G 13: 103,987,339 (GRCm39) I407T probably damaging Het
Fggy A G 4: 95,814,965 (GRCm39) Y440C probably damaging Het
Flrt2 A T 12: 95,747,566 (GRCm39) N635Y possibly damaging Het
Fnbp1l A G 3: 122,350,140 (GRCm39) I357T probably benign Het
Gulp1 A G 1: 44,793,513 (GRCm39) H58R possibly damaging Het
Hid1 A T 11: 115,245,464 (GRCm39) V446E probably damaging Het
Igfn1 A G 1: 135,897,561 (GRCm39) S1002P possibly damaging Het
Klri1 A G 6: 129,675,118 (GRCm39) probably null Het
Kmt2d A C 15: 98,762,259 (GRCm39) L409R probably damaging Het
Ltn1 A C 16: 87,208,669 (GRCm39) S810A possibly damaging Het
Mysm1 G A 4: 94,836,648 (GRCm39) Q721* probably null Het
Nae1 A G 8: 105,254,017 (GRCm39) V105A possibly damaging Het
Nagpa C T 16: 5,021,503 (GRCm39) V83M probably damaging Het
Nrg2 G A 18: 36,154,975 (GRCm39) T503M probably damaging Het
Nrxn3 A G 12: 89,221,789 (GRCm39) M150V possibly damaging Het
Or5p52 C A 7: 107,502,093 (GRCm39) H56Q probably benign Het
Or8g28 A G 9: 39,169,498 (GRCm39) S157P probably damaging Het
Papola T A 12: 105,773,468 (GRCm39) D162E probably benign Het
Plxnc1 T C 10: 94,680,041 (GRCm39) probably null Het
Ppp1r16b T A 2: 158,588,585 (GRCm39) probably null Het
Ptprq T A 10: 107,474,691 (GRCm39) E1338V probably damaging Het
Puf60 G A 15: 75,942,633 (GRCm39) H437Y probably benign Het
Qsox2 C T 2: 26,110,650 (GRCm39) V189I probably benign Het
Rad51ap2 A T 12: 11,507,776 (GRCm39) D566V probably benign Het
Rb1cc1 T A 1: 6,333,237 (GRCm39) probably null Het
Rfpl4b C T 10: 38,697,049 (GRCm39) C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,291,739 (GRCm39) probably null Het
Scara5 A C 14: 65,968,539 (GRCm39) M271L probably benign Het
Sel1l2 A G 2: 140,127,157 (GRCm39) L118P probably damaging Het
Sema6a T A 18: 47,439,416 (GRCm39) probably benign Het
Siglech T A 7: 55,418,252 (GRCm39) H73Q probably benign Het
Sim1 A G 10: 50,860,205 (GRCm39) D689G probably benign Het
Skp2 T C 15: 9,139,530 (GRCm39) E55G possibly damaging Het
Slc1a1 T A 19: 28,871,869 (GRCm39) V114E probably benign Het
Slc26a6 G A 9: 108,738,916 (GRCm39) G614D probably benign Het
Sptbn2 C T 19: 4,795,992 (GRCm39) Q1724* probably null Het
Tet3 T C 6: 83,345,050 (GRCm39) T1796A probably damaging Het
Tmem117 A C 15: 94,829,714 (GRCm39) D183A possibly damaging Het
Trmt44 A G 5: 35,721,403 (GRCm39) S587P probably benign Het
Ttn G T 2: 76,619,166 (GRCm39) probably benign Het
Tubgcp5 G A 7: 55,458,285 (GRCm39) V399M probably benign Het
Txndc2 T A 17: 65,945,130 (GRCm39) D349V probably damaging Het
Uggt2 T A 14: 119,250,915 (GRCm39) N1194I probably benign Het
Vmn1r178 A T 7: 23,593,329 (GRCm39) I53L probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Other mutations in Cntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cntn5 APN 9 9,976,302 (GRCm39) missense probably damaging 0.99
IGL01118:Cntn5 APN 9 9,831,565 (GRCm39) missense possibly damaging 0.94
IGL01328:Cntn5 APN 9 9,781,773 (GRCm39) missense probably damaging 1.00
IGL01445:Cntn5 APN 9 9,693,489 (GRCm39) splice site probably benign
IGL01505:Cntn5 APN 9 9,706,092 (GRCm39) missense probably damaging 1.00
IGL01556:Cntn5 APN 9 9,673,913 (GRCm39) missense probably benign
IGL01804:Cntn5 APN 9 9,831,542 (GRCm39) missense probably damaging 0.99
IGL02173:Cntn5 APN 9 9,748,401 (GRCm39) missense probably damaging 1.00
IGL02250:Cntn5 APN 9 10,145,336 (GRCm39) missense probably damaging 1.00
IGL02366:Cntn5 APN 9 9,984,060 (GRCm39) splice site probably benign
IGL02565:Cntn5 APN 9 10,145,343 (GRCm39) nonsense probably null
IGL02593:Cntn5 APN 9 9,833,504 (GRCm39) missense probably damaging 1.00
IGL02743:Cntn5 APN 9 9,984,115 (GRCm39) missense probably damaging 1.00
IGL02976:Cntn5 APN 9 10,419,104 (GRCm39) unclassified probably benign
IGL03103:Cntn5 APN 9 9,972,817 (GRCm39) splice site probably benign
IGL03114:Cntn5 APN 9 9,748,457 (GRCm39) missense probably damaging 1.00
IGL03156:Cntn5 APN 9 9,673,882 (GRCm39) missense probably damaging 1.00
IGL02802:Cntn5 UTSW 9 10,048,683 (GRCm39) splice site probably null
R0243:Cntn5 UTSW 9 9,781,780 (GRCm39) missense probably damaging 1.00
R0385:Cntn5 UTSW 9 9,972,875 (GRCm39) missense probably damaging 1.00
R0541:Cntn5 UTSW 9 9,673,407 (GRCm39) splice site probably benign
R0827:Cntn5 UTSW 9 9,666,943 (GRCm39) missense possibly damaging 0.88
R1029:Cntn5 UTSW 9 9,831,577 (GRCm39) missense probably damaging 1.00
R1440:Cntn5 UTSW 9 10,145,344 (GRCm39) missense probably damaging 1.00
R1463:Cntn5 UTSW 9 9,673,801 (GRCm39) critical splice donor site probably null
R1536:Cntn5 UTSW 9 9,976,321 (GRCm39) missense possibly damaging 0.78
R1761:Cntn5 UTSW 9 10,172,059 (GRCm39) missense probably benign 0.01
R1764:Cntn5 UTSW 9 9,673,988 (GRCm39) missense probably benign
R1859:Cntn5 UTSW 9 9,972,839 (GRCm39) missense probably damaging 1.00
R1888:Cntn5 UTSW 9 9,984,082 (GRCm39) missense possibly damaging 0.95
R1888:Cntn5 UTSW 9 9,984,082 (GRCm39) missense possibly damaging 0.95
R1950:Cntn5 UTSW 9 9,781,774 (GRCm39) missense probably damaging 1.00
R2143:Cntn5 UTSW 9 9,748,420 (GRCm39) missense probably damaging 0.98
R2145:Cntn5 UTSW 9 9,748,420 (GRCm39) missense probably damaging 0.98
R2437:Cntn5 UTSW 9 10,048,758 (GRCm39) nonsense probably null
R2440:Cntn5 UTSW 9 10,171,960 (GRCm39) missense possibly damaging 0.91
R2504:Cntn5 UTSW 9 10,172,126 (GRCm39) missense probably benign
R3054:Cntn5 UTSW 9 10,419,076 (GRCm39) missense probably benign 0.30
R3056:Cntn5 UTSW 9 10,419,076 (GRCm39) missense probably benign 0.30
R3804:Cntn5 UTSW 9 9,781,668 (GRCm39) splice site probably benign
R4164:Cntn5 UTSW 9 9,781,681 (GRCm39) missense probably damaging 1.00
R4444:Cntn5 UTSW 9 9,704,947 (GRCm39) missense probably damaging 1.00
R4472:Cntn5 UTSW 9 10,048,776 (GRCm39) missense probably damaging 1.00
R4576:Cntn5 UTSW 9 9,673,297 (GRCm39) missense probably benign 0.10
R4624:Cntn5 UTSW 9 9,704,809 (GRCm39) nonsense probably null
R4652:Cntn5 UTSW 9 9,704,917 (GRCm39) missense possibly damaging 0.68
R4664:Cntn5 UTSW 9 10,144,214 (GRCm39) missense possibly damaging 0.71
R4679:Cntn5 UTSW 9 9,970,536 (GRCm39) missense probably benign 0.09
R4829:Cntn5 UTSW 9 9,976,288 (GRCm39) missense probably damaging 1.00
R4929:Cntn5 UTSW 9 9,976,400 (GRCm39) critical splice acceptor site probably null
R5211:Cntn5 UTSW 9 9,704,894 (GRCm39) missense possibly damaging 0.88
R5406:Cntn5 UTSW 9 9,833,465 (GRCm39) missense probably damaging 1.00
R5468:Cntn5 UTSW 9 9,743,633 (GRCm39) missense probably damaging 1.00
R5584:Cntn5 UTSW 9 9,661,457 (GRCm39) missense possibly damaging 0.91
R5688:Cntn5 UTSW 9 9,748,427 (GRCm39) missense probably damaging 1.00
R5762:Cntn5 UTSW 9 9,748,394 (GRCm39) missense possibly damaging 0.95
R6141:Cntn5 UTSW 9 10,144,162 (GRCm39) missense probably benign
R6147:Cntn5 UTSW 9 10,012,894 (GRCm39) missense probably damaging 0.98
R6325:Cntn5 UTSW 9 10,144,328 (GRCm39) splice site probably null
R6377:Cntn5 UTSW 9 9,743,657 (GRCm39) missense probably damaging 1.00
R6774:Cntn5 UTSW 9 10,144,222 (GRCm39) missense probably damaging 1.00
R7117:Cntn5 UTSW 9 10,904,704 (GRCm39) start gained probably benign
R7252:Cntn5 UTSW 9 9,831,640 (GRCm39) missense probably benign 0.00
R7363:Cntn5 UTSW 9 10,172,021 (GRCm39) missense probably benign 0.00
R7401:Cntn5 UTSW 9 9,833,466 (GRCm39) missense probably benign 0.13
R7488:Cntn5 UTSW 9 9,970,570 (GRCm39) missense probably damaging 0.99
R7548:Cntn5 UTSW 9 9,673,415 (GRCm39) splice site probably null
R7662:Cntn5 UTSW 9 9,661,390 (GRCm39) missense probably benign 0.17
R7718:Cntn5 UTSW 9 9,984,133 (GRCm39) missense probably benign
R7719:Cntn5 UTSW 9 9,704,903 (GRCm39) missense probably damaging 1.00
R7788:Cntn5 UTSW 9 9,704,934 (GRCm39) missense probably benign 0.01
R7864:Cntn5 UTSW 9 9,984,182 (GRCm39) missense probably damaging 0.98
R7937:Cntn5 UTSW 9 9,748,450 (GRCm39) missense probably damaging 1.00
R8117:Cntn5 UTSW 9 9,673,955 (GRCm39) missense probably benign 0.33
R8159:Cntn5 UTSW 9 10,145,386 (GRCm39) missense possibly damaging 0.91
R8349:Cntn5 UTSW 9 9,666,840 (GRCm39) critical splice donor site probably null
R8449:Cntn5 UTSW 9 9,666,840 (GRCm39) critical splice donor site probably null
R8779:Cntn5 UTSW 9 10,171,920 (GRCm39) missense probably benign
R8789:Cntn5 UTSW 9 9,673,292 (GRCm39) missense probably damaging 1.00
R8985:Cntn5 UTSW 9 10,171,960 (GRCm39) missense possibly damaging 0.91
R9370:Cntn5 UTSW 9 9,833,520 (GRCm39) missense probably benign 0.19
R9382:Cntn5 UTSW 9 9,673,817 (GRCm39) missense probably benign
R9781:Cntn5 UTSW 9 10,048,686 (GRCm39) critical splice donor site probably null
Z1177:Cntn5 UTSW 9 10,090,241 (GRCm39) missense probably damaging 1.00
Z1177:Cntn5 UTSW 9 9,673,967 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTAAGGAGCAATTGATGAGCTTCCAG -3'
(R):5'- CTGCCAAAAGAACGAAACCCTATTTGAG -3'

Sequencing Primer
(F):5'- aaacaaacaaacaagcaaacaaac -3'
(R):5'- GAACGAAACCCTATTTGAGTTTGATG -3'
Posted On 2014-05-23