Incidental Mutation 'R1746:Rad51ap2'
ID 194001
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission 039778-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1746 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11507776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 566 (D566V)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect probably benign
Transcript: ENSMUST00000124065
AA Change: D566V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: D566V

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,927,717 (GRCm39) probably null Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Aknad1 A G 3: 108,659,099 (GRCm39) T38A possibly damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arhgap21 T C 2: 20,865,910 (GRCm39) E902G probably damaging Het
Atg2b A G 12: 105,635,588 (GRCm39) S227P possibly damaging Het
Atp2c2 C T 8: 120,461,182 (GRCm39) probably benign Het
Atxn10 T C 15: 85,260,864 (GRCm39) V203A probably damaging Het
Chd9 A C 8: 91,737,326 (GRCm39) E1468D probably benign Het
Cntn5 T A 9: 9,831,577 (GRCm39) D601V probably damaging Het
Col4a2 G A 8: 11,496,020 (GRCm39) G1547D probably benign Het
Cul1 A G 6: 47,485,179 (GRCm39) E270G probably damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dmgdh C A 13: 93,888,933 (GRCm39) T857K probably benign Het
Ednra T G 8: 78,398,211 (GRCm39) T279P probably benign Het
Erbin A G 13: 103,987,339 (GRCm39) I407T probably damaging Het
Fggy A G 4: 95,814,965 (GRCm39) Y440C probably damaging Het
Flrt2 A T 12: 95,747,566 (GRCm39) N635Y possibly damaging Het
Fnbp1l A G 3: 122,350,140 (GRCm39) I357T probably benign Het
Gulp1 A G 1: 44,793,513 (GRCm39) H58R possibly damaging Het
Hid1 A T 11: 115,245,464 (GRCm39) V446E probably damaging Het
Igfn1 A G 1: 135,897,561 (GRCm39) S1002P possibly damaging Het
Klri1 A G 6: 129,675,118 (GRCm39) probably null Het
Kmt2d A C 15: 98,762,259 (GRCm39) L409R probably damaging Het
Ltn1 A C 16: 87,208,669 (GRCm39) S810A possibly damaging Het
Mysm1 G A 4: 94,836,648 (GRCm39) Q721* probably null Het
Nae1 A G 8: 105,254,017 (GRCm39) V105A possibly damaging Het
Nagpa C T 16: 5,021,503 (GRCm39) V83M probably damaging Het
Nrg2 G A 18: 36,154,975 (GRCm39) T503M probably damaging Het
Nrxn3 A G 12: 89,221,789 (GRCm39) M150V possibly damaging Het
Or5p52 C A 7: 107,502,093 (GRCm39) H56Q probably benign Het
Or8g28 A G 9: 39,169,498 (GRCm39) S157P probably damaging Het
Papola T A 12: 105,773,468 (GRCm39) D162E probably benign Het
Plxnc1 T C 10: 94,680,041 (GRCm39) probably null Het
Ppp1r16b T A 2: 158,588,585 (GRCm39) probably null Het
Ptprq T A 10: 107,474,691 (GRCm39) E1338V probably damaging Het
Puf60 G A 15: 75,942,633 (GRCm39) H437Y probably benign Het
Qsox2 C T 2: 26,110,650 (GRCm39) V189I probably benign Het
Rb1cc1 T A 1: 6,333,237 (GRCm39) probably null Het
Rfpl4b C T 10: 38,697,049 (GRCm39) C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,291,739 (GRCm39) probably null Het
Scara5 A C 14: 65,968,539 (GRCm39) M271L probably benign Het
Sel1l2 A G 2: 140,127,157 (GRCm39) L118P probably damaging Het
Sema6a T A 18: 47,439,416 (GRCm39) probably benign Het
Siglech T A 7: 55,418,252 (GRCm39) H73Q probably benign Het
Sim1 A G 10: 50,860,205 (GRCm39) D689G probably benign Het
Skp2 T C 15: 9,139,530 (GRCm39) E55G possibly damaging Het
Slc1a1 T A 19: 28,871,869 (GRCm39) V114E probably benign Het
Slc26a6 G A 9: 108,738,916 (GRCm39) G614D probably benign Het
Sptbn2 C T 19: 4,795,992 (GRCm39) Q1724* probably null Het
Tet3 T C 6: 83,345,050 (GRCm39) T1796A probably damaging Het
Tmem117 A C 15: 94,829,714 (GRCm39) D183A possibly damaging Het
Trmt44 A G 5: 35,721,403 (GRCm39) S587P probably benign Het
Ttn G T 2: 76,619,166 (GRCm39) probably benign Het
Tubgcp5 G A 7: 55,458,285 (GRCm39) V399M probably benign Het
Txndc2 T A 17: 65,945,130 (GRCm39) D349V probably damaging Het
Uggt2 T A 14: 119,250,915 (GRCm39) N1194I probably benign Het
Vmn1r178 A T 7: 23,593,329 (GRCm39) I53L probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACTAGAAGTTGCAAATTGCGAGGGA -3'
(R):5'- CCAAGCTGATCTTCAGAGTTATCGCC -3'

Sequencing Primer
(F):5'- ACATGTTCTTCAACGGGTTAAG -3'
(R):5'- GCCATAGCATTAATCTGGTCACTG -3'
Posted On 2014-05-23