Incidental Mutation 'R1746:Nrxn3'
ID 194002
Institutional Source Beutler Lab
Gene Symbol Nrxn3
Ensembl Gene ENSMUSG00000066392
Gene Name neurexin III
Synonyms 4933401A11Rik, D12Bwg0831e, neurexin III alpha, neurexin III alpha, neurexin III beta, neurexin III beta, 9330112C09Rik
MMRRC Submission 039778-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1746 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 88689646-90301709 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89221789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 150 (M150V)
Ref Sequence ENSEMBL: ENSMUSP00000127926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]
AlphaFold Q6P9K9
Predicted Effect possibly damaging
Transcript: ENSMUST00000057634
AA Change: M150V

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392
AA Change: M150V

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163134
AA Change: M523V

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392
AA Change: M523V

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 843 4.87e-26 SMART
LamG 891 1027 7.08e-37 SMART
EGF 1052 1086 1.99e1 SMART
LamG 1114 1271 1.14e-17 SMART
low complexity region 1312 1328 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1499 1514 N/A INTRINSIC
4.1m 1517 1535 4.38e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167103
AA Change: M523V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392
AA Change: M523V

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 834 5.76e-28 SMART
LamG 882 1018 7.08e-37 SMART
EGF 1043 1077 1.99e1 SMART
LamG 1105 1262 1.14e-17 SMART
low complexity region 1303 1319 N/A INTRINSIC
low complexity region 1354 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167734
Predicted Effect possibly damaging
Transcript: ENSMUST00000167887
AA Change: M150V

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392
AA Change: M150V

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190626
AA Change: M150V

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392
AA Change: M150V

DomainStartEndE-ValueType
LamG 94 246 2.1e-43 SMART
EGF 273 307 2e-4 SMART
LamG 332 470 3.1e-28 SMART
LamG 518 654 4.4e-39 SMART
EGF 688 722 9.6e-2 SMART
LamG 750 877 1.1e-22 SMART
low complexity region 918 934 N/A INTRINSIC
low complexity region 972 1000 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194420
Meta Mutation Damage Score 0.3175 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,927,717 (GRCm39) probably null Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Aknad1 A G 3: 108,659,099 (GRCm39) T38A possibly damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arhgap21 T C 2: 20,865,910 (GRCm39) E902G probably damaging Het
Atg2b A G 12: 105,635,588 (GRCm39) S227P possibly damaging Het
Atp2c2 C T 8: 120,461,182 (GRCm39) probably benign Het
Atxn10 T C 15: 85,260,864 (GRCm39) V203A probably damaging Het
Chd9 A C 8: 91,737,326 (GRCm39) E1468D probably benign Het
Cntn5 T A 9: 9,831,577 (GRCm39) D601V probably damaging Het
Col4a2 G A 8: 11,496,020 (GRCm39) G1547D probably benign Het
Cul1 A G 6: 47,485,179 (GRCm39) E270G probably damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dmgdh C A 13: 93,888,933 (GRCm39) T857K probably benign Het
Ednra T G 8: 78,398,211 (GRCm39) T279P probably benign Het
Erbin A G 13: 103,987,339 (GRCm39) I407T probably damaging Het
Fggy A G 4: 95,814,965 (GRCm39) Y440C probably damaging Het
Flrt2 A T 12: 95,747,566 (GRCm39) N635Y possibly damaging Het
Fnbp1l A G 3: 122,350,140 (GRCm39) I357T probably benign Het
Gulp1 A G 1: 44,793,513 (GRCm39) H58R possibly damaging Het
Hid1 A T 11: 115,245,464 (GRCm39) V446E probably damaging Het
Igfn1 A G 1: 135,897,561 (GRCm39) S1002P possibly damaging Het
Klri1 A G 6: 129,675,118 (GRCm39) probably null Het
Kmt2d A C 15: 98,762,259 (GRCm39) L409R probably damaging Het
Ltn1 A C 16: 87,208,669 (GRCm39) S810A possibly damaging Het
Mysm1 G A 4: 94,836,648 (GRCm39) Q721* probably null Het
Nae1 A G 8: 105,254,017 (GRCm39) V105A possibly damaging Het
Nagpa C T 16: 5,021,503 (GRCm39) V83M probably damaging Het
Nrg2 G A 18: 36,154,975 (GRCm39) T503M probably damaging Het
Or5p52 C A 7: 107,502,093 (GRCm39) H56Q probably benign Het
Or8g28 A G 9: 39,169,498 (GRCm39) S157P probably damaging Het
Papola T A 12: 105,773,468 (GRCm39) D162E probably benign Het
Plxnc1 T C 10: 94,680,041 (GRCm39) probably null Het
Ppp1r16b T A 2: 158,588,585 (GRCm39) probably null Het
Ptprq T A 10: 107,474,691 (GRCm39) E1338V probably damaging Het
Puf60 G A 15: 75,942,633 (GRCm39) H437Y probably benign Het
Qsox2 C T 2: 26,110,650 (GRCm39) V189I probably benign Het
Rad51ap2 A T 12: 11,507,776 (GRCm39) D566V probably benign Het
Rb1cc1 T A 1: 6,333,237 (GRCm39) probably null Het
Rfpl4b C T 10: 38,697,049 (GRCm39) C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,291,739 (GRCm39) probably null Het
Scara5 A C 14: 65,968,539 (GRCm39) M271L probably benign Het
Sel1l2 A G 2: 140,127,157 (GRCm39) L118P probably damaging Het
Sema6a T A 18: 47,439,416 (GRCm39) probably benign Het
Siglech T A 7: 55,418,252 (GRCm39) H73Q probably benign Het
Sim1 A G 10: 50,860,205 (GRCm39) D689G probably benign Het
Skp2 T C 15: 9,139,530 (GRCm39) E55G possibly damaging Het
Slc1a1 T A 19: 28,871,869 (GRCm39) V114E probably benign Het
Slc26a6 G A 9: 108,738,916 (GRCm39) G614D probably benign Het
Sptbn2 C T 19: 4,795,992 (GRCm39) Q1724* probably null Het
Tet3 T C 6: 83,345,050 (GRCm39) T1796A probably damaging Het
Tmem117 A C 15: 94,829,714 (GRCm39) D183A possibly damaging Het
Trmt44 A G 5: 35,721,403 (GRCm39) S587P probably benign Het
Ttn G T 2: 76,619,166 (GRCm39) probably benign Het
Tubgcp5 G A 7: 55,458,285 (GRCm39) V399M probably benign Het
Txndc2 T A 17: 65,945,130 (GRCm39) D349V probably damaging Het
Uggt2 T A 14: 119,250,915 (GRCm39) N1194I probably benign Het
Vmn1r178 A T 7: 23,593,329 (GRCm39) I53L probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Other mutations in Nrxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrxn3 APN 12 90,171,366 (GRCm39) missense probably damaging 1.00
IGL00961:Nrxn3 APN 12 90,171,320 (GRCm39) missense possibly damaging 0.95
IGL01073:Nrxn3 APN 12 89,221,510 (GRCm39) missense probably benign 0.25
IGL01338:Nrxn3 APN 12 89,221,804 (GRCm39) missense possibly damaging 0.86
IGL01377:Nrxn3 APN 12 89,499,782 (GRCm39) critical splice donor site probably null
IGL01409:Nrxn3 APN 12 89,477,128 (GRCm39) missense probably damaging 1.00
IGL01764:Nrxn3 APN 12 90,171,524 (GRCm39) missense possibly damaging 0.48
IGL02063:Nrxn3 APN 12 88,762,565 (GRCm39) missense possibly damaging 0.86
IGL02171:Nrxn3 APN 12 89,159,933 (GRCm39) missense probably damaging 1.00
IGL02309:Nrxn3 APN 12 89,943,175 (GRCm39) missense probably damaging 0.99
IGL02340:Nrxn3 APN 12 90,171,402 (GRCm39) missense possibly damaging 0.82
IGL02343:Nrxn3 APN 12 88,762,123 (GRCm39) missense probably damaging 1.00
IGL02600:Nrxn3 APN 12 89,478,682 (GRCm39) splice site probably benign
IGL02735:Nrxn3 APN 12 89,221,624 (GRCm39) missense probably benign 0.16
IGL03061:Nrxn3 APN 12 89,478,698 (GRCm39) nonsense probably null
IGL03206:Nrxn3 APN 12 89,227,278 (GRCm39) missense possibly damaging 0.88
IGL03337:Nrxn3 APN 12 89,221,790 (GRCm39) missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89,226,971 (GRCm39) missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89,226,971 (GRCm39) missense probably damaging 1.00
R0144:Nrxn3 UTSW 12 89,315,162 (GRCm39) missense probably damaging 1.00
R0334:Nrxn3 UTSW 12 89,780,412 (GRCm39) critical splice donor site probably null
R0531:Nrxn3 UTSW 12 88,762,112 (GRCm39) missense probably damaging 1.00
R0840:Nrxn3 UTSW 12 90,298,567 (GRCm39) missense possibly damaging 0.68
R1324:Nrxn3 UTSW 12 89,221,466 (GRCm39) missense possibly damaging 0.89
R1438:Nrxn3 UTSW 12 90,298,909 (GRCm39) missense probably damaging 1.00
R1484:Nrxn3 UTSW 12 89,221,547 (GRCm39) missense probably damaging 0.99
R1621:Nrxn3 UTSW 12 88,762,480 (GRCm39) missense probably benign
R1637:Nrxn3 UTSW 12 89,321,238 (GRCm39) missense possibly damaging 0.94
R1659:Nrxn3 UTSW 12 90,299,165 (GRCm39) missense probably damaging 1.00
R1801:Nrxn3 UTSW 12 90,250,356 (GRCm39) missense probably damaging 1.00
R1912:Nrxn3 UTSW 12 88,762,112 (GRCm39) missense probably damaging 1.00
R1940:Nrxn3 UTSW 12 89,227,151 (GRCm39) missense probably damaging 0.98
R1993:Nrxn3 UTSW 12 89,227,181 (GRCm39) missense possibly damaging 0.59
R2002:Nrxn3 UTSW 12 90,299,089 (GRCm39) missense probably damaging 1.00
R2125:Nrxn3 UTSW 12 89,227,290 (GRCm39) splice site probably null
R2179:Nrxn3 UTSW 12 89,221,448 (GRCm39) missense probably damaging 1.00
R2207:Nrxn3 UTSW 12 89,315,082 (GRCm39) missense probably damaging 1.00
R2284:Nrxn3 UTSW 12 89,477,135 (GRCm39) missense probably damaging 1.00
R2433:Nrxn3 UTSW 12 89,943,160 (GRCm39) missense probably damaging 1.00
R2969:Nrxn3 UTSW 12 89,321,241 (GRCm39) missense probably damaging 1.00
R3053:Nrxn3 UTSW 12 89,221,871 (GRCm39) missense probably damaging 0.99
R3076:Nrxn3 UTSW 12 89,227,186 (GRCm39) missense probably damaging 1.00
R3078:Nrxn3 UTSW 12 89,227,186 (GRCm39) missense probably damaging 1.00
R4033:Nrxn3 UTSW 12 89,499,771 (GRCm39) missense probably damaging 1.00
R4222:Nrxn3 UTSW 12 89,499,762 (GRCm39) nonsense probably null
R4321:Nrxn3 UTSW 12 90,166,005 (GRCm39) missense probably damaging 1.00
R4470:Nrxn3 UTSW 12 90,171,515 (GRCm39) missense probably damaging 1.00
R4471:Nrxn3 UTSW 12 90,171,515 (GRCm39) missense probably damaging 1.00
R4472:Nrxn3 UTSW 12 90,171,515 (GRCm39) missense probably damaging 1.00
R4686:Nrxn3 UTSW 12 89,477,421 (GRCm39) missense probably damaging 0.99
R4776:Nrxn3 UTSW 12 90,298,730 (GRCm39) missense possibly damaging 0.55
R4821:Nrxn3 UTSW 12 90,171,483 (GRCm39) missense probably damaging 0.99
R4869:Nrxn3 UTSW 12 88,762,352 (GRCm39) missense possibly damaging 0.95
R4910:Nrxn3 UTSW 12 89,227,130 (GRCm39) missense possibly damaging 0.72
R4960:Nrxn3 UTSW 12 88,761,971 (GRCm39) missense possibly damaging 0.79
R4990:Nrxn3 UTSW 12 89,227,244 (GRCm39) missense probably damaging 1.00
R4991:Nrxn3 UTSW 12 89,227,244 (GRCm39) missense probably damaging 1.00
R5057:Nrxn3 UTSW 12 89,221,804 (GRCm39) missense probably damaging 0.99
R5329:Nrxn3 UTSW 12 89,780,354 (GRCm39) missense possibly damaging 0.92
R5888:Nrxn3 UTSW 12 89,478,855 (GRCm39) missense possibly damaging 0.91
R6249:Nrxn3 UTSW 12 89,221,448 (GRCm39) missense probably damaging 1.00
R6264:Nrxn3 UTSW 12 90,299,011 (GRCm39) missense probably damaging 1.00
R6373:Nrxn3 UTSW 12 89,943,237 (GRCm39) missense probably damaging 1.00
R6401:Nrxn3 UTSW 12 89,221,770 (GRCm39) missense possibly damaging 0.46
R6434:Nrxn3 UTSW 12 88,762,285 (GRCm39) missense probably benign 0.32
R6528:Nrxn3 UTSW 12 89,479,819 (GRCm39) missense probably damaging 1.00
R6612:Nrxn3 UTSW 12 89,780,102 (GRCm39) intron probably benign
R6632:Nrxn3 UTSW 12 89,159,924 (GRCm39) missense probably damaging 1.00
R6874:Nrxn3 UTSW 12 90,298,964 (GRCm39) missense probably damaging 0.99
R7122:Nrxn3 UTSW 12 89,477,377 (GRCm39) missense probably damaging 1.00
R7328:Nrxn3 UTSW 12 88,762,345 (GRCm39) missense probably benign
R7352:Nrxn3 UTSW 12 88,817,063 (GRCm39) missense probably benign
R7425:Nrxn3 UTSW 12 89,479,870 (GRCm39) nonsense probably null
R7444:Nrxn3 UTSW 12 89,477,464 (GRCm39) missense probably damaging 1.00
R7483:Nrxn3 UTSW 12 89,477,232 (GRCm39) missense probably damaging 1.00
R7599:Nrxn3 UTSW 12 89,478,832 (GRCm39) missense probably benign
R7738:Nrxn3 UTSW 12 88,817,074 (GRCm39) missense possibly damaging 0.68
R7765:Nrxn3 UTSW 12 89,780,254 (GRCm39) missense probably benign 0.03
R8139:Nrxn3 UTSW 12 90,171,438 (GRCm39) missense probably benign 0.01
R8192:Nrxn3 UTSW 12 90,171,569 (GRCm39) missense probably benign 0.08
R8351:Nrxn3 UTSW 12 89,477,413 (GRCm39) missense probably damaging 1.00
R8368:Nrxn3 UTSW 12 90,298,815 (GRCm39) nonsense probably null
R8397:Nrxn3 UTSW 12 90,298,583 (GRCm39) missense probably benign 0.17
R8426:Nrxn3 UTSW 12 88,762,097 (GRCm39) missense possibly damaging 0.91
R8451:Nrxn3 UTSW 12 89,477,413 (GRCm39) missense probably damaging 1.00
R8777:Nrxn3 UTSW 12 89,227,234 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Nrxn3 UTSW 12 89,227,234 (GRCm39) missense probably damaging 1.00
R8844:Nrxn3 UTSW 12 89,153,920 (GRCm39) missense possibly damaging 0.88
R8870:Nrxn3 UTSW 12 90,171,560 (GRCm39) missense probably benign 0.00
R9043:Nrxn3 UTSW 12 89,227,252 (GRCm39) missense probably damaging 1.00
R9102:Nrxn3 UTSW 12 90,298,924 (GRCm39) missense probably benign 0.01
R9167:Nrxn3 UTSW 12 89,154,068 (GRCm39) missense probably damaging 1.00
R9445:Nrxn3 UTSW 12 89,499,737 (GRCm39) nonsense probably null
R9447:Nrxn3 UTSW 12 89,221,678 (GRCm39) missense probably benign 0.35
X0019:Nrxn3 UTSW 12 90,165,995 (GRCm39) missense probably damaging 1.00
Z1176:Nrxn3 UTSW 12 89,484,679 (GRCm39) missense possibly damaging 0.45
Z1176:Nrxn3 UTSW 12 89,153,825 (GRCm39) nonsense probably null
Z1177:Nrxn3 UTSW 12 90,298,619 (GRCm39) missense probably benign 0.05
Z1177:Nrxn3 UTSW 12 89,227,082 (GRCm39) missense probably damaging 1.00
Z1177:Nrxn3 UTSW 12 88,762,458 (GRCm39) missense probably benign 0.00
Z1177:Nrxn3 UTSW 12 90,298,888 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGACTTTCGCACCACTGAGCC -3'
(R):5'- CTTGACAGTCCCTGTGGTCAGAATG -3'

Sequencing Primer
(F):5'- AGCCCAACGGCCTGATTC -3'
(R):5'- CTATCGCTGAGAACATTGTGC -3'
Posted On 2014-05-23