Mutagenetix > Incidental Mutation

Incidental Mutation 'R1747:Aox2'

194024

Institutional Source

Beutler Lab

Gene Symbol

Aox2

Ensembl Gene

ENSMUSG00000079554

Gene Name

aldehyde oxidase 2

Synonyms

Aox3l1

MMRRC Submission

039779-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R1747 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58278326-58380259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58339592 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1000 (D1000V)

Ref Sequence

ENSEMBL: ENSMUSP00000110006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114366]

AlphaFold

Q5SGK3

Predicted Effect

probably benign
Transcript: ENSMUST00000114366
AA Change: D1000V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: D1000V

Domain	Start	End	E-Value	Type
Pfam:Fer2	13	83	3.4e-9	PFAM
Pfam:Fer2_2	92	166	4.2e-30	PFAM
Pfam:FAD_binding_5	241	421	5.1e-46	PFAM
CO_deh_flav_C	428	532	1.4e-23	SMART
Ald_Xan_dh_C	604	707	4.64e-47	SMART
Pfam:Ald_Xan_dh_C2	717	1251	1.3e-178	PFAM
low complexity region	1257	1271	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.7%

Validation Efficiency

97% (65/67)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	C	T	8: 13,558,814	S117N	probably damaging	Het
A830010M20Rik	T	C	5: 107,451,999	S119P	probably damaging	Het
Acat3	A	G	17: 12,924,808	I349T	possibly damaging	Het
Add3	A	G	19: 53,242,550	N552S	probably benign	Het
Ak3	G	T	19: 29,022,861	P217T	possibly damaging	Het
Ap1m2	A	G	9: 21,305,686	M118T	probably damaging	Het
Arhgap28	C	A	17: 67,901,309	A105S	probably benign	Het
Arhgef28	T	C	13: 97,936,824	E1368G	probably damaging	Het
Armc7	G	A	11: 115,488,757	V94I	probably benign	Het
Asxl1	C	A	2: 153,393,454	T223N	possibly damaging	Het
Cltc	T	C	11: 86,707,081	K1078E	probably damaging	Het
Cpne8	G	A	15: 90,584,915	T158I	probably benign	Het
Csn1s2b	T	C	5: 87,816,670		probably benign	Het
Cyp3a59	A	G	5: 146,104,758	I371V	probably benign	Het
Dennd4c	T	C	4: 86,807,438	F710L	probably damaging	Het
Diaph3	T	C	14: 87,073,337	D126G	probably damaging	Het
Dnm3	G	A	1: 162,313,584	R369C	probably damaging	Het
Dst	A	C	1: 34,160,709	Q86P	probably damaging	Het
Ern2	C	A	7: 122,173,819		probably null	Het
Ern2	T	A	7: 122,173,820		probably null	Het
Exoc6	T	A	19: 37,639,769		probably null	Het
Glg1	G	A	8: 111,197,673	R228C	probably damaging	Het
Gm4736	G	A	6: 132,115,670		noncoding transcript	Het
Hmcn2	G	C	2: 31,457,985	G4881A	probably benign	Het
Htr2a	T	G	14: 74,706,153	F391C	probably damaging	Het
Htr5b	A	T	1: 121,527,918	V91E	probably damaging	Het
Ifi44	T	A	3: 151,749,285	H101L	probably benign	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Klhl6	T	A	16: 19,947,028	H608L	probably benign	Het
Lrp4	T	C	2: 91,492,621	V1150A	probably damaging	Het
Lyst	T	C	13: 13,757,422	F3545S	probably benign	Het
Magi3	T	C	3: 104,034,173	D822G	possibly damaging	Het
Nbas	G	A	12: 13,335,898	S721N	probably benign	Het
Nog	T	A	11: 89,301,582	M147L	probably benign	Het
Npr1	C	T	3: 90,458,669	C605Y	possibly damaging	Het
Olfr1053	G	A	2: 86,314,867	L140F	probably benign	Het
Olfr866	A	C	9: 20,027,317	V207G	probably benign	Het
Pgs1	A	G	11: 118,001,631	S10G	probably benign	Het
Pla2g4c	T	C	7: 13,337,730		probably benign	Het
Prdm14	C	T	1: 13,122,403	V371I	possibly damaging	Het
Prom1	C	T	5: 44,007,031	V703I	probably benign	Het
Ptprk	A	G	10: 28,354,692	T260A	possibly damaging	Het
Scnn1g	A	T	7: 121,760,463	I390F	probably damaging	Het
Scrt2	C	T	2: 152,093,718	H264Y	probably damaging	Het
Sel1l3	C	T	5: 53,145,545	E661K	possibly damaging	Het
Skiv2l	G	T	17: 34,847,806	P162H	probably benign	Het
Slc10a5	G	T	3: 10,335,391	Q70K	probably benign	Het
Smg8	A	G	11: 87,085,303	V484A	possibly damaging	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Stag1	T	A	9: 100,888,300	S630T	probably benign	Het
Thyn1	A	C	9: 27,005,213	Q98P	probably damaging	Het
Ttc7	A	G	17: 87,307,015	R203G	possibly damaging	Het
Ttn	T	C	2: 76,878,516		probably benign	Het
Vmn1r236	C	T	17: 21,286,917	S99L	probably benign	Het
Vmn2r50	T	A	7: 10,047,678	H380L	probably benign	Het
Vmn2r73	A	T	7: 85,858,167	C646S	probably damaging	Het
Wnt10b	A	G	15: 98,774,333	S168P	probably benign	Het
Zc3h7a	A	G	16: 11,145,253	M748T	possibly damaging	Het
Zfp804b	C	G	5: 6,770,217	E913Q	probably benign	Het
Zfp974	G	T	7: 27,911,081	F406L	possibly damaging	Het
Zic4	G	A	9: 91,384,146	C274Y	probably damaging	Het

Other mutations in Aox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Aox2	APN	1	58322801	missense	possibly damaging	0.73
IGL01288:Aox2	APN	1	58294407	missense	probably damaging	0.99
IGL01383:Aox2	APN	1	58294305	missense	probably benign	0.09
IGL01734:Aox2	APN	1	58354310	missense	possibly damaging	0.95
IGL01793:Aox2	APN	1	58336624	missense	possibly damaging	0.79
IGL01834:Aox2	APN	1	58309024	missense	possibly damaging	0.90
IGL01924:Aox2	APN	1	58287743	missense	possibly damaging	0.90
IGL02591:Aox2	APN	1	58358999	nonsense	probably null
IGL02645:Aox2	APN	1	58334724	missense	probably damaging	1.00
IGL02710:Aox2	APN	1	58334769	critical splice donor site	probably null
IGL02801:Aox2	APN	1	58354177	missense	probably damaging	1.00
IGL02988:Aox2	APN	1	58337350	missense	probably benign
IGL03104:Aox2	APN	1	58282759	missense	probably benign
IGL03121:Aox2	APN	1	58358954	missense	probably damaging	1.00
IGL03191:Aox2	APN	1	58359069	missense	probably null	0.98
IGL03236:Aox2	APN	1	58309997	nonsense	probably null
IGL03409:Aox2	APN	1	58354429	missense	possibly damaging	0.91
PIT4362001:Aox2	UTSW	1	58282680	missense	probably damaging	1.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0267:Aox2	UTSW	1	58339446	splice site	probably benign
R0388:Aox2	UTSW	1	58354406	missense	probably damaging	1.00
R0409:Aox2	UTSW	1	58336624	missense	possibly damaging	0.90
R0547:Aox2	UTSW	1	58310042	missense	probably damaging	0.96
R0630:Aox2	UTSW	1	58337321	splice site	probably benign
R0726:Aox2	UTSW	1	58334782	splice site	probably benign
R0734:Aox2	UTSW	1	58305341	missense	probably benign	0.22
R0831:Aox2	UTSW	1	58339683	missense	probably benign	0.28
R0961:Aox2	UTSW	1	58310071	missense	probably benign	0.00
R1404:Aox2	UTSW	1	58346212	splice site	probably benign
R1512:Aox2	UTSW	1	58307351	missense	probably benign	0.00
R1573:Aox2	UTSW	1	58309027	missense	probably benign	0.00
R1592:Aox2	UTSW	1	58300694	missense	probably benign	0.00
R1768:Aox2	UTSW	1	58354195	missense	probably benign	0.00
R1809:Aox2	UTSW	1	58294325	missense	probably benign
R1823:Aox2	UTSW	1	58312359	missense	probably benign	0.02
R1834:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1835:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1836:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R2219:Aox2	UTSW	1	58349130	splice site	probably null
R2220:Aox2	UTSW	1	58349130	splice site	probably null
R2508:Aox2	UTSW	1	58343673	missense	probably benign	0.38
R2942:Aox2	UTSW	1	58337381	missense	probably benign	0.03
R2967:Aox2	UTSW	1	58322834	missense	probably damaging	0.96
R3082:Aox2	UTSW	1	58283600	splice site	probably benign
R3161:Aox2	UTSW	1	58304438	missense	possibly damaging	0.91
R3408:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R3803:Aox2	UTSW	1	58289899	splice site	probably null
R3894:Aox2	UTSW	1	58334678	critical splice acceptor site	probably null
R4214:Aox2	UTSW	1	58307444	critical splice donor site	probably null
R4249:Aox2	UTSW	1	58299819	missense	probably benign	0.01
R4666:Aox2	UTSW	1	58304597	nonsense	probably null
R4668:Aox2	UTSW	1	58334694	missense	possibly damaging	0.63
R4703:Aox2	UTSW	1	58358957	missense	possibly damaging	0.78
R4758:Aox2	UTSW	1	58332582	missense	probably benign	0.00
R4890:Aox2	UTSW	1	58334703	missense	probably benign	0.11
R4900:Aox2	UTSW	1	58305385	missense	probably benign
R4924:Aox2	UTSW	1	58305344	missense	probably damaging	1.00
R4970:Aox2	UTSW	1	58310095	splice site	probably null
R5112:Aox2	UTSW	1	58310095	splice site	probably null
R5987:Aox2	UTSW	1	58307359	missense	probably benign	0.00
R6239:Aox2	UTSW	1	58305391	critical splice donor site	probably null
R6273:Aox2	UTSW	1	58339672	missense	probably benign	0.00
R6291:Aox2	UTSW	1	58330806	missense	probably damaging	0.98
R6334:Aox2	UTSW	1	58307407	nonsense	probably null
R6764:Aox2	UTSW	1	58350282	missense	probably damaging	0.97
R6766:Aox2	UTSW	1	58349068	missense	possibly damaging	0.95
R6789:Aox2	UTSW	1	58304485	missense	probably benign	0.01
R6804:Aox2	UTSW	1	58304598	missense	probably benign	0.04
R7007:Aox2	UTSW	1	58330892	missense	probably damaging	1.00
R7015:Aox2	UTSW	1	58282758	missense	probably benign	0.00
R7055:Aox2	UTSW	1	58299768	missense	probably benign	0.08
R7089:Aox2	UTSW	1	58336649	missense	probably benign	0.01
R7157:Aox2	UTSW	1	58283492	missense	probably benign	0.00
R7303:Aox2	UTSW	1	58334765	nonsense	probably null
R7426:Aox2	UTSW	1	58289983	nonsense	probably null
R7762:Aox2	UTSW	1	58349104	missense	probably damaging	1.00
R7899:Aox2	UTSW	1	58281237	splice site	probably null
R7942:Aox2	UTSW	1	58337431	missense	probably damaging	1.00
R7975:Aox2	UTSW	1	58309028	missense	probably benign	0.02
R8029:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R8032:Aox2	UTSW	1	58350283	missense	probably benign	0.01
R8147:Aox2	UTSW	1	58300662	missense	probably benign	0.02
R8165:Aox2	UTSW	1	58308929	missense	probably benign	0.08
R8326:Aox2	UTSW	1	58295887	missense	probably benign
R8770:Aox2	UTSW	1	58339604	missense	probably benign	0.10
R8973:Aox2	UTSW	1	58289954	missense	probably benign	0.34
R9015:Aox2	UTSW	1	58343692	missense	probably damaging	1.00
R9097:Aox2	UTSW	1	58287728	missense	possibly damaging	0.82
R9101:Aox2	UTSW	1	58332637	missense	probably benign	0.03
R9108:Aox2	UTSW	1	58282692	missense	probably damaging	1.00
R9180:Aox2	UTSW	1	58339618	nonsense	probably null
R9258:Aox2	UTSW	1	58312356	missense	probably damaging	1.00
R9293:Aox2	UTSW	1	58322794	missense	possibly damaging	0.86
R9519:Aox2	UTSW	1	58334767	missense	probably damaging	0.98
R9581:Aox2	UTSW	1	58330896	critical splice donor site	probably null
Z1177:Aox2	UTSW	1	58354397	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- TTGGAGAGAGTGAAACCACTCCCC -3'
(R):5'- TGTGGCATCCTCGAACATCAGAATC -3'

Sequencing Primer
(F):5'- agatagataatgggtgaatggatgg -3'
(R):5'- CATCAGAATCAGTGATTGGACC -3'

Posted On

2014-05-23