Incidental Mutation 'R1747:Aox2'
ID 194024
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
MMRRC Submission 039779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R1747 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58339592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1000 (D1000V)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably benign
Transcript: ENSMUST00000114366
AA Change: D1000V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: D1000V

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik C T 8: 13,558,814 S117N probably damaging Het
A830010M20Rik T C 5: 107,451,999 S119P probably damaging Het
Acat3 A G 17: 12,924,808 I349T possibly damaging Het
Add3 A G 19: 53,242,550 N552S probably benign Het
Ak3 G T 19: 29,022,861 P217T possibly damaging Het
Ap1m2 A G 9: 21,305,686 M118T probably damaging Het
Arhgap28 C A 17: 67,901,309 A105S probably benign Het
Arhgef28 T C 13: 97,936,824 E1368G probably damaging Het
Armc7 G A 11: 115,488,757 V94I probably benign Het
Asxl1 C A 2: 153,393,454 T223N possibly damaging Het
Cltc T C 11: 86,707,081 K1078E probably damaging Het
Cpne8 G A 15: 90,584,915 T158I probably benign Het
Csn1s2b T C 5: 87,816,670 probably benign Het
Cyp3a59 A G 5: 146,104,758 I371V probably benign Het
Dennd4c T C 4: 86,807,438 F710L probably damaging Het
Diaph3 T C 14: 87,073,337 D126G probably damaging Het
Dnm3 G A 1: 162,313,584 R369C probably damaging Het
Dst A C 1: 34,160,709 Q86P probably damaging Het
Ern2 C A 7: 122,173,819 probably null Het
Ern2 T A 7: 122,173,820 probably null Het
Exoc6 T A 19: 37,639,769 probably null Het
Glg1 G A 8: 111,197,673 R228C probably damaging Het
Gm4736 G A 6: 132,115,670 noncoding transcript Het
Hmcn2 G C 2: 31,457,985 G4881A probably benign Het
Htr2a T G 14: 74,706,153 F391C probably damaging Het
Htr5b A T 1: 121,527,918 V91E probably damaging Het
Ifi44 T A 3: 151,749,285 H101L probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl6 T A 16: 19,947,028 H608L probably benign Het
Lrp4 T C 2: 91,492,621 V1150A probably damaging Het
Lyst T C 13: 13,757,422 F3545S probably benign Het
Magi3 T C 3: 104,034,173 D822G possibly damaging Het
Nbas G A 12: 13,335,898 S721N probably benign Het
Nog T A 11: 89,301,582 M147L probably benign Het
Npr1 C T 3: 90,458,669 C605Y possibly damaging Het
Olfr1053 G A 2: 86,314,867 L140F probably benign Het
Olfr866 A C 9: 20,027,317 V207G probably benign Het
Pgs1 A G 11: 118,001,631 S10G probably benign Het
Pla2g4c T C 7: 13,337,730 probably benign Het
Prdm14 C T 1: 13,122,403 V371I possibly damaging Het
Prom1 C T 5: 44,007,031 V703I probably benign Het
Ptprk A G 10: 28,354,692 T260A possibly damaging Het
Scnn1g A T 7: 121,760,463 I390F probably damaging Het
Scrt2 C T 2: 152,093,718 H264Y probably damaging Het
Sel1l3 C T 5: 53,145,545 E661K possibly damaging Het
Skiv2l G T 17: 34,847,806 P162H probably benign Het
Slc10a5 G T 3: 10,335,391 Q70K probably benign Het
Smg8 A G 11: 87,085,303 V484A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stag1 T A 9: 100,888,300 S630T probably benign Het
Thyn1 A C 9: 27,005,213 Q98P probably damaging Het
Ttc7 A G 17: 87,307,015 R203G possibly damaging Het
Ttn T C 2: 76,878,516 probably benign Het
Vmn1r236 C T 17: 21,286,917 S99L probably benign Het
Vmn2r50 T A 7: 10,047,678 H380L probably benign Het
Vmn2r73 A T 7: 85,858,167 C646S probably damaging Het
Wnt10b A G 15: 98,774,333 S168P probably benign Het
Zc3h7a A G 16: 11,145,253 M748T possibly damaging Het
Zfp804b C G 5: 6,770,217 E913Q probably benign Het
Zfp974 G T 7: 27,911,081 F406L possibly damaging Het
Zic4 G A 9: 91,384,146 C274Y probably damaging Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTGGAGAGAGTGAAACCACTCCCC -3'
(R):5'- TGTGGCATCCTCGAACATCAGAATC -3'

Sequencing Primer
(F):5'- agatagataatgggtgaatggatgg -3'
(R):5'- CATCAGAATCAGTGATTGGACC -3'
Posted On 2014-05-23